ID: 1129429942

View in Genome Browser
Species Human (GRCh38)
Location 15:75492515-75492537
Sequence CAGGACAATGAGAATGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129429942_1129429950 23 Left 1129429942 15:75492515-75492537 CCTGACCCATTCTCATTGTCCTG 0: 1
1: 0
2: 3
3: 11
4: 194
Right 1129429950 15:75492561-75492583 GATCCCCTCAGCGGATCCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 42
1129429942_1129429947 1 Left 1129429942 15:75492515-75492537 CCTGACCCATTCTCATTGTCCTG 0: 1
1: 0
2: 3
3: 11
4: 194
Right 1129429947 15:75492539-75492561 CCTACACTCATATCCAAGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 78
1129429942_1129429954 28 Left 1129429942 15:75492515-75492537 CCTGACCCATTCTCATTGTCCTG 0: 1
1: 0
2: 3
3: 11
4: 194
Right 1129429954 15:75492566-75492588 CCTCAGCGGATCCAAAGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 106
1129429942_1129429949 14 Left 1129429942 15:75492515-75492537 CCTGACCCATTCTCATTGTCCTG 0: 1
1: 0
2: 3
3: 11
4: 194
Right 1129429949 15:75492552-75492574 CCAAGTTTGGATCCCCTCAGCGG 0: 1
1: 0
2: 2
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129429942 Original CRISPR CAGGACAATGAGAATGGGTC AGG (reversed) Intronic
900509217 1:3050529-3050551 CAGGAGAATGAAGATGGGGCAGG + Intergenic
900617277 1:3571095-3571117 CAGGACACAGAGAGAGGGTCTGG + Intronic
900830441 1:4961488-4961510 CAGGACAAGGAGCATGAGCCAGG + Intergenic
903100488 1:21024397-21024419 CAGCTCATTGAGAATGGGCCAGG + Intronic
903634400 1:24800572-24800594 CAGTTCATTGAGAATGGGCCAGG + Intronic
904353293 1:29922726-29922748 CAGGAGGCTGAGGATGGGTCTGG + Intergenic
904698059 1:32341618-32341640 CAGGCGAATGAGAATAGCTCTGG - Intergenic
905699947 1:40004499-40004521 CAAGACAATGTGATTGGGTGGGG + Intergenic
907397270 1:54200065-54200087 TAAGAAAATGAGAATGGGTTGGG + Exonic
909659795 1:78069198-78069220 CAGGAAACTGAGAATGGGAAAGG - Intronic
910288536 1:85579163-85579185 AAGCACAATGAGAATCTGTCAGG - Intergenic
911111356 1:94190677-94190699 TAAGACTCTGAGAATGGGTCTGG - Intronic
912200685 1:107454443-107454465 TAGGCCTATGAGAATGGGTAGGG - Intronic
912791050 1:112651388-112651410 CAAGACAATGAGAATAGTTCAGG + Intronic
913451259 1:118994166-118994188 CAGGACAGTGAGAAATGGTGGGG + Intergenic
915657074 1:157369529-157369551 CATGGTAATGGGAATGGGTCAGG + Intergenic
915671917 1:157496787-157496809 CATGGTAATGGGAATGGGTCAGG - Intergenic
916568185 1:166000806-166000828 CAGGGCAATGAGCGTGGATCTGG + Intergenic
916664736 1:166956503-166956525 CAGGACAATGATAAAAGGTGGGG + Intronic
916740045 1:167639787-167639809 TAAAACAATGAGAATGGGCCGGG - Intronic
919076899 1:192824581-192824603 AAGGAAAAAGAGAGTGGGTCTGG - Intergenic
921622755 1:217344180-217344202 CAGGACCATGCGAAGGGGTCTGG + Intergenic
924196955 1:241618115-241618137 TAGTAGAATGTGAATGGGTCTGG - Intronic
1063023842 10:2157875-2157897 TAGGATAATCAGAATGGGTTTGG + Intergenic
1065884279 10:30063077-30063099 CAGGAAAATGGGAGTGGGTAGGG - Intronic
1065932449 10:30491656-30491678 CAGGAGAATGAGGATGGCTACGG + Intergenic
1067035581 10:42913894-42913916 CAAGACAGTGAGAATTGGCCAGG + Intergenic
1069487876 10:68836386-68836408 GAGGAAGAAGAGAATGGGTCTGG + Intronic
1070972457 10:80578811-80578833 AAGGCCAATGAGCAAGGGTCTGG + Intronic
1071231985 10:83598550-83598572 CAGAAAAATGAGAATGTGTGTGG - Intergenic
1072695688 10:97601289-97601311 CGGGGCAATGAAAATGGGTTTGG - Intronic
1072724833 10:97806226-97806248 CAAGAACATGAGAATGGGGCAGG - Intergenic
1074779470 10:116790663-116790685 CTAGACAATGAGATGGGGTCTGG - Intergenic
1075002927 10:118811062-118811084 CGGGACCAGGAGAATGGGGCAGG - Intergenic
1076993599 11:288260-288282 CAGGACATTGAGGCCGGGTCAGG + Intergenic
1079279952 11:19078098-19078120 CAGCACAAGAGGAATGGGTCAGG + Intergenic
1079408555 11:20165615-20165637 CAGGACAAGGGGAGTGGGCCAGG - Intergenic
1081473737 11:43403378-43403400 CTAGATAATGAGAATGGGACTGG - Intronic
1081979091 11:47255017-47255039 CAGGAAACTGGGAATGGGGCAGG + Intronic
1084924506 11:72502001-72502023 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1086498203 11:87425549-87425571 CAGGACAGTGAGAGTGGAACTGG - Intergenic
1087246770 11:95848018-95848040 CAGGAAAATGTGGATGGCTCAGG + Intronic
1090043525 11:123311333-123311355 AAGGAGAATGAGAATTGGTAGGG - Intergenic
1090323421 11:125864177-125864199 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1090583241 11:128182376-128182398 CAGAACCATGAAAGTGGGTCAGG + Intergenic
1091263383 11:134251877-134251899 CAAGACAATCAGAATGTGCCTGG + Intronic
1091485714 12:885691-885713 CAGGACAATGAGTATGGGGCTGG - Exonic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1093558480 12:20508126-20508148 CAGTGCAATGAGAATGTGCCTGG - Intronic
1094386830 12:29903477-29903499 CATCACAATGAAAATGGCTCAGG + Intergenic
1096400217 12:51299721-51299743 CAGGGTAATGAGAAAGGGTGTGG + Intronic
1104201105 12:126590184-126590206 GAGGACTATGAGGAGGGGTCAGG - Intergenic
1105543836 13:21337660-21337682 GAGGGCAATGAGACTGGGTGAGG - Intergenic
1106116642 13:26823593-26823615 CAGGACAATGAGAATGTAAGTGG + Intergenic
1106587061 13:31066788-31066810 CAGGACCCTGAGAAAGGGCCAGG - Intergenic
1107561388 13:41560325-41560347 CAGGACGGTGAGACTGGTTCTGG - Intergenic
1111418097 13:87976098-87976120 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1112351837 13:98641949-98641971 CAGGACAATGACAGTGAGACAGG - Intergenic
1113466900 13:110519455-110519477 CAGGACAGAGAGGATGGGTGTGG - Intergenic
1114428366 14:22639491-22639513 CAGCTCATTGAGAACGGGTCAGG + Intergenic
1116480826 14:45390336-45390358 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1119026351 14:71155901-71155923 CTGGACAATGAGGATGGGGGCGG + Intergenic
1119649186 14:76371651-76371673 CAGGAAAATGGGGATGGGTGAGG + Intronic
1123132384 14:105999382-105999404 CAGGACAGCAAGAATGGCTCAGG - Intergenic
1129053174 15:72799184-72799206 CTGGAGAATGAGAAGGGGACAGG - Intergenic
1129429942 15:75492515-75492537 CAGGACAATGAGAATGGGTCAGG - Intronic
1130727336 15:86452849-86452871 CAGGGCAAAGAGAATGAATCTGG - Intronic
1131127688 15:89869077-89869099 CAGCTCATTGAGAACGGGTCAGG + Intronic
1132222518 15:100115557-100115579 CAGCTCAAAGAGGATGGGTCAGG + Intronic
1133593072 16:7265032-7265054 CAAGACAAAAAGAATGGGACTGG - Intronic
1133937947 16:10284138-10284160 CAGGAAAGTGAGAAGGGGTGGGG - Intergenic
1134884257 16:17775866-17775888 AAGGACAATGAACATGGGGCAGG - Intergenic
1137284089 16:47000797-47000819 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1137571314 16:49568069-49568091 CTGGATAAAGAGACTGGGTCAGG + Intronic
1140033266 16:71355101-71355123 CTGGACAAGGAGCTTGGGTCTGG + Intergenic
1140377126 16:74453604-74453626 CAGGACACTGAAGATGTGTCGGG + Intronic
1142912573 17:3108012-3108034 CAGGAGAAAGAGAATGGAACAGG - Intergenic
1142972789 17:3623987-3624009 CGGGAGAATGAGAATAGGCCGGG - Intronic
1143277243 17:5721333-5721355 CAGCTCATTGAGAATGGGCCGGG - Intergenic
1144234298 17:13242301-13242323 CAGGAGAATGAGAAGTGTTCTGG + Intergenic
1144647893 17:16987748-16987770 CAGGACCCTGAGAATGGCTGGGG + Intergenic
1144703575 17:17353489-17353511 CAGGACAGGCAGAAAGGGTCAGG + Intergenic
1145717353 17:27034332-27034354 CAGCTCATTGAGAATGGGCCAGG + Intergenic
1145989874 17:29072946-29072968 CAGGGCAATGTGAATAGGTTGGG - Intergenic
1146644005 17:34564370-34564392 CAGGAAAATGAGGAAGAGTCAGG - Intergenic
1148267459 17:46238066-46238088 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1148596122 17:48857095-48857117 CAAGAACATGAGAATGGGCCGGG - Intronic
1149534561 17:57422625-57422647 CTGGAGAATGAGCATGGGTCTGG - Intronic
1150557860 17:66269478-66269500 CAGCTCATTGAGAACGGGTCAGG + Intergenic
1151022000 17:70627756-70627778 CAGCACAACTTGAATGGGTCTGG + Intergenic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152730185 17:81966386-81966408 CAGGACAGTGGGGATGGGGCAGG - Intergenic
1153419431 18:4887370-4887392 CAGAACTATGATAATGGCTCTGG - Intergenic
1154406055 18:14092235-14092257 CAGGACCAGGATAAGGGGTCAGG + Intronic
1155308160 18:24499000-24499022 CAGGACAATGAGACTTGGGGAGG - Intergenic
1156362793 18:36399229-36399251 CAGGACACTGAAATTGGGCCAGG - Intronic
1158396141 18:57079596-57079618 CAGGAGCATGAGAATGGCGCGGG - Intergenic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1164559521 19:29279802-29279824 CAGGACATAGTGACTGGGTCAGG - Intergenic
1165146699 19:33735373-33735395 CAGGAGAGTGTGAATGGGACCGG + Intronic
1166675373 19:44737754-44737776 CAGGATACTGAGGATGGGGCAGG - Intergenic
1167524447 19:49974999-49975021 CAGGAGACTGGGAATGGCTCAGG - Intergenic
1167560727 19:50225537-50225559 GAGGTCAGTGAGAATGGGGCAGG - Intronic
927757742 2:25723112-25723134 CAGCTCAATGAGAACGGGCCAGG - Intergenic
927817310 2:26230216-26230238 CAGGGCAAAGAAAATGGGACTGG - Exonic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
929561940 2:42961562-42961584 CAGGACCATGAGTCAGGGTCAGG - Intergenic
935107578 2:100059857-100059879 GAGGACAATGAAAATGTATCTGG + Intronic
938623166 2:133078622-133078644 CAAGACAAGGAGAATGAGACAGG + Intronic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939552076 2:143627703-143627725 GAGGACAAAGAGGCTGGGTCTGG + Intronic
940197762 2:151114486-151114508 GAGGACTATGAGGCTGGGTCTGG + Intergenic
941886628 2:170534729-170534751 CAGGACACTGAGGCTGGGTGTGG - Intronic
942613910 2:177770049-177770071 CAGGCAAATGAGAATAGGTGAGG - Intronic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
942735896 2:179112161-179112183 CAGTACAAAGGGAATGGGTTTGG + Intronic
943004935 2:182377302-182377324 CAGGAGAAAGATAAAGGGTCAGG - Intronic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
946153416 2:217791287-217791309 AAAGAGAATGAGAAAGGGTCTGG - Intergenic
946656823 2:221957644-221957666 CAAAACAAGGAGGATGGGTCAGG + Intergenic
1168891727 20:1299446-1299468 CAGGACACTGAGAATAGAGCTGG + Intronic
1169525287 20:6417658-6417680 CAGGACAATGAGGAAGGGGAAGG + Intergenic
1170424669 20:16227025-16227047 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1172257920 20:33536157-33536179 CAGCTCATTGAGAATGGGCCGGG - Intronic
1172473009 20:35214803-35214825 CTGGACATTGAGACTGAGTCGGG + Intergenic
1177706632 21:24714482-24714504 CAGGACAAGGTGCATGGGTTAGG - Intergenic
1181414040 22:22746562-22746584 CAGGACACTGAGCAGGGGCCTGG + Intronic
1183840953 22:40500881-40500903 CAGCTCATTGAGAATGGGCCAGG - Intronic
1184244991 22:43231335-43231357 AAGGATAATGAGGAGGGGTCTGG - Intronic
951040307 3:17982289-17982311 CAGGACAATCATGATGGGTCGGG - Intronic
951706860 3:25552379-25552401 CAGGATAATGAAAATGGCTGGGG + Intronic
954145569 3:48632744-48632766 CAGGAAGATGAGAGTGGGTGAGG - Intronic
954483444 3:50823653-50823675 CAGCTCATTGAGAATGGGCCAGG - Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
956576596 3:70759175-70759197 GAGGTCAATAAGAATGGGTGAGG + Intergenic
959677890 3:109056757-109056779 CATGACCAATAGAATGGGTCAGG - Intronic
961502730 3:127349587-127349609 CTGGAAAAGGAGACTGGGTCTGG + Intergenic
962915233 3:139895336-139895358 CATGGCAATGAGGATGGATCTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967369222 3:188724839-188724861 CTGGGCAATGAGACTGGGCCTGG - Intronic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
970260134 4:14215870-14215892 AAGGAAAATGAGGAAGGGTCAGG + Intergenic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
976534929 4:86201299-86201321 CAGGAGATTGAAAATGGTTCTGG - Intronic
979477139 4:121171637-121171659 CAGGAAAATGAAAATGATTCAGG + Intronic
979729056 4:123999707-123999729 GAGGATGATGAGAATGGATCTGG - Intergenic
979737435 4:124104722-124104744 CAGGAAAAGTAGAATGGCTCAGG + Intergenic
979825382 4:125226941-125226963 TGGGCAAATGAGAATGGGTCAGG + Intergenic
981000953 4:139828837-139828859 CAGGACCATGACAATGGGAGAGG - Intronic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
983256450 4:165405716-165405738 CAGGGCAAAGAAAATGGGACTGG - Intronic
983644563 4:169976783-169976805 CCGGACAATAAGAAGGAGTCAGG + Intergenic
985255719 4:188068230-188068252 CAGCTCATTGAGAATGGGCCAGG + Intergenic
986421270 5:7586414-7586436 CAGGAGGATGAGAATGGATGAGG - Intronic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
988842964 5:35101091-35101113 CGGGACAATGGCAGTGGGTCAGG - Intronic
989540822 5:42616722-42616744 CAGGACAATATTTATGGGTCGGG + Intronic
992129046 5:73673161-73673183 CAGCACAATGGAAATGGGTAGGG - Intronic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
993247522 5:85469320-85469342 CAAGAAAATGAGACTGGTTCAGG + Intergenic
994117690 5:96079242-96079264 CAGGACAAAGAGTGTGGGTAGGG - Intergenic
996483117 5:123998088-123998110 CAGGACACTGATAATGTGTCTGG + Intergenic
997817361 5:137032363-137032385 CAGGACAATGAGAATGAGCCTGG + Intronic
1001999535 5:176189902-176189924 CAGGACACTAAAAATGGGACAGG + Intergenic
1002649632 5:180682004-180682026 CAGGACACTAAAAATGGGACAGG - Intergenic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002907500 6:1462725-1462747 CAGGACTAAGAGAATGGTTCAGG + Intergenic
1003407961 6:5838928-5838950 CTGGAGAATGAGGATGGGGCGGG + Intergenic
1003554306 6:7126310-7126332 CTGGGCAACAAGAATGGGTCGGG - Intronic
1006713634 6:36098583-36098605 GAGGAAAATGTGAATGAGTCAGG - Intronic
1007151826 6:39701205-39701227 CAGGACAAAGAGATTGGCTCTGG + Intronic
1007707409 6:43799292-43799314 CAGGAGAATGGGGATGGCTCAGG - Intergenic
1008977537 6:57445573-57445595 CAGGGCAGTGAGAAAGGGTTGGG - Intronic
1009165677 6:60338527-60338549 CAGGGCAGTGAGAAAGGGTTGGG - Intergenic
1009381682 6:63039478-63039500 CAGGACACTCAGAATGTATCAGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012852671 6:104465703-104465725 CAGGGCAATGTAAAAGGGTCAGG + Intergenic
1014897942 6:126926759-126926781 CAGGAAATTGAGAAGCGGTCGGG - Intergenic
1015063392 6:128996209-128996231 CAGGAGAATGAGAAAGAGTTTGG + Intronic
1016026748 6:139295065-139295087 CAGGACAATGAGAAAGAATAGGG - Intergenic
1016271789 6:142298588-142298610 TAGGATAATGATAATAGGTCGGG + Intergenic
1017507909 6:155085389-155085411 CAGGTCAATGAGAAAAGGTGGGG - Intronic
1017593814 6:156007096-156007118 CAGGACCAGGAAAATGGGTTGGG - Intergenic
1017598306 6:156053847-156053869 TAGGACAAGGTGAAAGGGTCAGG + Intergenic
1021962981 7:25891173-25891195 AAGGACAAGGAGAATGGCTGGGG - Intergenic
1023854678 7:44175481-44175503 CAGGAGAATGAGAGGGGGCCAGG + Intronic
1024214371 7:47234795-47234817 GAGGGCTATGAGAATGGGCCAGG - Intergenic
1029218362 7:98968958-98968980 CAGGTCCATGTGAATCGGTCAGG + Intronic
1032188411 7:129747778-129747800 CAGCACCATGAGAATGGTTGTGG + Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG + Intronic
1036506872 8:9364862-9364884 CAGCTCATTGAGAATGGGCCAGG - Intergenic
1036598382 8:10236281-10236303 CAGGAGAATAAGAATGGGAGAGG + Intronic
1041005963 8:53497266-53497288 CAGGACAATGAGACAGGGCATGG + Intergenic
1042048056 8:64676536-64676558 CAGGACAGTGACATTGGGTCTGG + Intronic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1048201443 8:132377502-132377524 CAGGAGGATGAGGCTGGGTCAGG + Intronic
1048285084 8:133135260-133135282 CAAGACAATGAGGATGGAGCTGG + Intergenic
1049609973 8:143550352-143550374 CAGGGCAATGAGATGGGGTTAGG - Intergenic
1055133760 9:72806032-72806054 CAGCTCATTGAGAATGGGCCCGG - Intronic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1058125772 9:101193143-101193165 TAGGACTAAGAAAATGGGTCTGG + Intronic
1061680053 9:132238538-132238560 CAGGCTAATAAGAAAGGGTCTGG + Intronic
1062570266 9:137181725-137181747 CAGGACAGTGAGGATGACTCAGG - Exonic
1190366449 X:49698797-49698819 CAGGACAATTAAGCTGGGTCTGG + Intergenic
1194617984 X:96131039-96131061 AAGGACAAAGAGAATGGGAGAGG - Intergenic
1196039639 X:111188300-111188322 CAGGACAGTGGGAATGGGCTTGG + Intronic