ID: 1129433672

View in Genome Browser
Species Human (GRCh38)
Location 15:75520362-75520384
Sequence CAGGATGAGCACTTTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129433672_1129433677 24 Left 1129433672 15:75520362-75520384 CCCAGATCAAAGTGCTCATCCTG 0: 1
1: 0
2: 3
3: 19
4: 314
Right 1129433677 15:75520409-75520431 AGTAAGATTTTCACACTTTAGGG 0: 1
1: 0
2: 1
3: 29
4: 286
1129433672_1129433676 23 Left 1129433672 15:75520362-75520384 CCCAGATCAAAGTGCTCATCCTG 0: 1
1: 0
2: 3
3: 19
4: 314
Right 1129433676 15:75520408-75520430 CAGTAAGATTTTCACACTTTAGG 0: 1
1: 0
2: 1
3: 17
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129433672 Original CRISPR CAGGATGAGCACTTTGATCT GGG (reversed) Intronic
901291405 1:8126997-8127019 CTGAATCTGCACTTTGATCTTGG + Intergenic
901977313 1:13005390-13005412 CAGGCTGAGCAATTTGAGCCTGG + Intronic
902004773 1:13223544-13223566 CAGGCTGAGCAATTTGAGCCTGG - Intergenic
902023991 1:13369279-13369301 CAGGCTGAGCAATTTGAGCCTGG - Exonic
902752699 1:18528340-18528362 CAGGAGGATCACTTGGGTCTGGG + Intergenic
904596015 1:31645878-31645900 CATGATCAGCACTGTGATTTTGG - Intergenic
905058668 1:35121005-35121027 CAGGATGAGCCCTTAGAGCCGGG + Intergenic
906489603 1:46258103-46258125 CAGGAGGATCACTTAGGTCTGGG - Intronic
906957732 1:50389578-50389600 CAGGAGGATCACTTGAATCTGGG - Intergenic
907282328 1:53359345-53359367 CAGGCTGAGTGCATTGATCTAGG - Intergenic
908134733 1:61118936-61118958 GAGGAGGATCGCTTTGATCTAGG + Intronic
911598923 1:99826792-99826814 CAGGAGGATCACTTGCATCTGGG + Intergenic
912050582 1:105524102-105524124 CACTATGACCACTTTGTTCTTGG + Intergenic
914788876 1:150858848-150858870 CAGGATGATCTCTTGGAGCTAGG - Intronic
914890957 1:151623063-151623085 CAGGATAATCACTTGGACCTGGG - Intronic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916309896 1:163386380-163386402 CAGGAGGATCACTTTAATCCAGG - Intergenic
916899703 1:169207454-169207476 CAGGATAAGAACCTTGCTCTAGG + Intronic
919161453 1:193835806-193835828 CAGGAGAAGCACTTGGATCCGGG + Intergenic
920218619 1:204378912-204378934 CAGGAGGATCACTTTGAGCCGGG + Intergenic
920996020 1:210992374-210992396 CAGGTTGAGGATTTTGAGCTAGG - Intronic
922285467 1:224167130-224167152 CAGGAGGATCACTTGAATCTGGG + Intergenic
922740776 1:228013257-228013279 CAGGCTGTGCACTTTAATGTTGG + Intronic
923522550 1:234746939-234746961 CAGGCTGTGCACTGTGACCTGGG - Intergenic
1064772936 10:18743026-18743048 CAGGATAATCACTTTAATCCAGG - Intergenic
1064915469 10:20451902-20451924 CAGGAGGATCACTTGAATCTGGG + Intergenic
1065069677 10:22009833-22009855 CAGGAGAATCACTTTAATCTGGG + Intergenic
1065492334 10:26294368-26294390 CCCGATGAGGAGTTTGATCTTGG - Intronic
1066456103 10:35573620-35573642 CAGGAGGAGCACTTGAAGCTGGG - Intergenic
1067150602 10:43729521-43729543 CAGGATGAGAAGTGTGATTTCGG - Intergenic
1067805651 10:49391265-49391287 CAGGTTGATCAGTTTGCTCTTGG - Intronic
1067841038 10:49679702-49679724 CAGGATGACCACTGCGTTCTTGG - Exonic
1068707974 10:60098115-60098137 TAGGATGAGCAGTTTCCTCTGGG + Intronic
1068805420 10:61189558-61189580 CAGGATAATCACTTGAATCTGGG + Intergenic
1069558241 10:69411922-69411944 CAGGAGGATCACTTGAATCTGGG - Intronic
1069792628 10:71032754-71032776 GAGGATGAGTAATTTGAGCTGGG + Intergenic
1070060376 10:72976823-72976845 CAGGAGGATCACTTGAATCTGGG + Intergenic
1072455983 10:95576106-95576128 CAGGAGGATCACTTGAATCTGGG + Intergenic
1074609783 10:115010397-115010419 CAGGAGAATCACTTTAATCTGGG + Intergenic
1074873071 10:117592793-117592815 CAGGAGGATCACTTTAGTCTAGG - Intergenic
1076525330 10:131109049-131109071 CAGGATGAGCACAGTGTTGTGGG + Intronic
1078113388 11:8420033-8420055 CAGGAGGATCACTTGAATCTAGG - Intronic
1079025615 11:16945645-16945667 CAGGATAAAAACTTTGATCCAGG + Intronic
1079241967 11:18727831-18727853 CAGCATGAGCACAGTGAGCTTGG - Intergenic
1079306050 11:19323642-19323664 CAGTTTGAACACTTTGACCTTGG - Intergenic
1082845874 11:57724943-57724965 CAGGAGAATCACTTTGAACTCGG + Intronic
1085359043 11:75869088-75869110 CAGGCTGAGGAACTTGATCTAGG + Intronic
1086148768 11:83585274-83585296 CAGGATGGAGACATTGATCTGGG + Intronic
1087520270 11:99224748-99224770 CAGGAGAAGCACTTGAATCTGGG - Intronic
1088134550 11:106538622-106538644 CTTGATGAGCACTTTCAACTTGG + Intergenic
1088673779 11:112170085-112170107 CAGGAGGATCACTTGAATCTAGG + Intronic
1090388475 11:126371255-126371277 CAGGAAAATCACTTGGATCTGGG - Intronic
1092202878 12:6597671-6597693 CAGGATAATCACTTGAATCTGGG + Intronic
1092910220 12:13139777-13139799 CAGGATGAGGAATTGGATGTAGG - Intronic
1092910311 12:13140185-13140207 CAGGATGAGGAATTGGATGTAGG - Intronic
1093465742 12:19446832-19446854 CAGGAGGATCACTTGGATCCAGG + Intronic
1093913062 12:24769057-24769079 CAGGAGAATCACTTGGATCTGGG + Intergenic
1094120992 12:26974007-26974029 CTGGAAGAGCCCTTTAATCTGGG + Exonic
1094821775 12:34231734-34231756 CGGGAGGATCACTTTAATCTAGG + Intergenic
1095539929 12:43297790-43297812 CAGGATAATCACTTGAATCTGGG - Intergenic
1096355210 12:50935579-50935601 CAGGATGATCACTTGGGCCTGGG - Intergenic
1096534219 12:52260675-52260697 CAGCAGGAGCACTGTCATCTCGG - Intronic
1096850246 12:54430881-54430903 CAGGATGAGCTCAGTGATCTAGG + Intergenic
1097577149 12:61409161-61409183 CATGATGAGCACATTGATGCTGG - Intergenic
1098891793 12:76017077-76017099 CAGGATGAGAATTGTTATCTGGG - Intergenic
1099691451 12:85958162-85958184 CAGGATAATCACTTGAATCTGGG - Exonic
1100588395 12:96000394-96000416 GAGGATAAGCACTTTAATCTGGG - Intergenic
1101122830 12:101601263-101601285 CAGTATGATCACTTTGACTTTGG - Intronic
1102167462 12:110818170-110818192 CAGGAGGATCACTTGAATCTAGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103116944 12:118342839-118342861 CAGGAGGATCACTTGCATCTGGG + Intronic
1104876993 12:132042042-132042064 CTGGAGGATCACTTTGACCTGGG - Intronic
1105374533 13:19831456-19831478 TAGAATGAGCACTTTATTCTAGG + Intronic
1105571311 13:21605281-21605303 CAGGATGATCACTGTGGTTTGGG + Intergenic
1108398271 13:50011547-50011569 CAGAATGAGCTCTTTACTCTGGG - Intronic
1110167815 13:72464487-72464509 CAGGAGGATCACTTTGAGCCCGG - Intergenic
1110820101 13:79905076-79905098 CAGGATAATCAGTTTGGTCTGGG - Intergenic
1111054957 13:82937601-82937623 CAGGATGAGAAATTTAGTCTGGG - Intergenic
1111681782 13:91451393-91451415 GAGGATGATCACTTGGGTCTGGG + Intronic
1111984728 13:95054453-95054475 CAGGAGAATCACTTTGACCTGGG + Intronic
1112147913 13:96722170-96722192 CAGGATCATCACTTGAATCTGGG + Intronic
1113699557 13:112374544-112374566 GAGGATGAGGAATTTGATCAGGG - Intergenic
1114231367 14:20785912-20785934 CAGGCTGAGAATTTTGAACTGGG + Intergenic
1114885326 14:26842689-26842711 CAGGCTGAACAATTTTATCTGGG - Intergenic
1116989583 14:51261469-51261491 CAGGTTGTGCACTTTGAACCTGG + Intergenic
1117999473 14:61509820-61509842 CAGGAGGATCACTTGAATCTGGG + Intronic
1118222468 14:63867828-63867850 CAGGAGGATCACTTAAATCTGGG + Intronic
1118985547 14:70751624-70751646 CAGGATGATCACTTGAATCTAGG + Intronic
1119497255 14:75090662-75090684 CAGGATGATCACTTGAACCTGGG - Intronic
1119750284 14:77072474-77072496 CAAGATGTGCAATTTGACCTTGG + Intergenic
1120175684 14:81290831-81290853 GAGGATGTCCCCTTTGATCTTGG - Intronic
1120263300 14:82216234-82216256 CAGGCTGAGCTCTGGGATCTGGG - Intergenic
1120739210 14:88089216-88089238 CAGGAGAATCACTTTAATCTGGG + Intergenic
1120917102 14:89719847-89719869 CATGATGATCATTTAGATCTGGG - Intergenic
1121194014 14:92054025-92054047 CAGGAGAATCACTTGGATCTGGG - Exonic
1121850961 14:97220763-97220785 CAGGATGATCACTTGAACCTGGG - Intergenic
1122082265 14:99274186-99274208 GAGGGTGAGCACTTTGCCCTAGG + Intergenic
1122229389 14:100298067-100298089 CAGGATGCGCACCCTGAGCTGGG - Intronic
1122488829 14:102099463-102099485 CAGGAGAATCACTTGGATCTGGG + Intronic
1122924721 14:104894341-104894363 CAGGATGGGCACCTCGTTCTCGG - Exonic
1125460859 15:39905381-39905403 CAGGAGGAGCACTTGAAACTTGG + Intronic
1125651100 15:41318521-41318543 CAGGAGGATCACTTGAATCTTGG - Intronic
1125924814 15:43554048-43554070 CAGGAGGATCACTTAAATCTAGG + Intronic
1125953388 15:43773146-43773168 CAGGATGAGACCTTTAATGTGGG + Exonic
1126454435 15:48846089-48846111 CAGGAGGATCACTTTAACCTAGG - Intronic
1127015946 15:54688257-54688279 CTGGAGGAGCATTTTGAACTGGG - Intergenic
1127782334 15:62328213-62328235 CAGAAGAATCACTTTGATCTGGG - Intergenic
1128187915 15:65659425-65659447 CAGGAGGATCACTTTGAGCCTGG - Exonic
1128422745 15:67509373-67509395 CAGGAGGATCACTTGAATCTGGG + Intergenic
1128495490 15:68196139-68196161 CAGGAGGATCACTTGAATCTGGG - Intronic
1129433672 15:75520362-75520384 CAGGATGAGCACTTTGATCTGGG - Intronic
1130104742 15:80920938-80920960 CAGGTTGGGCACTCTGATATTGG - Intronic
1130829524 15:87585108-87585130 CAGGAGGAGCAAATTGATTTGGG - Intergenic
1131044159 15:89299079-89299101 CAGGAAGACCACTTGAATCTGGG + Intronic
1131203682 15:90423324-90423346 CAGGAGGATCACTTTAACCTGGG - Intronic
1131464079 15:92640735-92640757 CAGGATAAACACTTTAACCTGGG - Intronic
1131859040 15:96632399-96632421 CTTGATGAGCAATTTGATCAGGG + Intergenic
1133380065 16:5322399-5322421 TAGGATGAGCCTTTTGGTCTGGG + Intergenic
1134859150 16:17545491-17545513 CAGGATAATCACTTGAATCTGGG + Intergenic
1135119823 16:19756089-19756111 CAGGAGGATCACTTGAATCTGGG + Intronic
1135319366 16:21481536-21481558 CAGGAGAATCACTTTAATCTGGG + Intergenic
1135372203 16:21913012-21913034 CAGGAGAATCACTTTAATCTGGG + Intergenic
1135439583 16:22457692-22457714 CAGGAGAATCACTTTAATCTGGG - Intergenic
1135659466 16:24282195-24282217 CAGGTTGAGTGCTTTGCTCTAGG + Intronic
1136329606 16:29563292-29563314 CAGGAGAATCACTTTAATCTGGG + Intergenic
1136394749 16:29986913-29986935 CTGGATGAGGAGTTTGAGCTTGG + Exonic
1136444235 16:30302999-30303021 CAGGAGAATCACTTTAATCTGGG + Intergenic
1136459835 16:30403042-30403064 CAGGAGGAGCACTTGAACCTGGG - Intergenic
1136594225 16:31236303-31236325 CAGGAGGATCACTTGTATCTGGG + Intergenic
1139413224 16:66783079-66783101 CAGGAGGACCACTTGAATCTAGG - Intronic
1139600130 16:67981514-67981536 CAGGAGGATCACTTTTACCTGGG - Intergenic
1141217165 16:82035421-82035443 GAGAATGAGCACTTTCTTCTCGG + Exonic
1141252436 16:82370542-82370564 CTGGATGATCACTTTGTGCTGGG + Intergenic
1144102281 17:11952384-11952406 CAGGAGGAGCACTTTGAGCCCGG - Intronic
1144556477 17:16286895-16286917 CAGGATGAGCAGTTTGCTGCGGG - Intronic
1145061206 17:19735391-19735413 CAGGAGGATCACTTGAATCTAGG - Intergenic
1145215323 17:21047156-21047178 CAGGAGGATCACTTAAATCTGGG + Intergenic
1145763130 17:27439038-27439060 CAGGCAGATCACTTTCATCTAGG + Intergenic
1148014962 17:44515129-44515151 CAGGAGGATCACTTGAATCTAGG - Intergenic
1149451106 17:56750655-56750677 CAAGATCAGCTGTTTGATCTTGG - Intergenic
1149959538 17:61092997-61093019 CAGGATAATCACTTTGAACCTGG - Intronic
1150296273 17:64009419-64009441 GAGGATGGGCACTTTGAGTTAGG + Intronic
1150796291 17:68240085-68240107 CCAGATCAGCACCTTGATCTTGG - Intergenic
1150880619 17:69022415-69022437 CAGGAGGATCACTTGAATCTGGG - Intronic
1151829980 17:76543798-76543820 CAGGATGAGCTCTGGGAACTGGG - Intronic
1152774438 17:82191757-82191779 CAGGAGGATCACTTGAATCTGGG - Intronic
1153159927 18:2192502-2192524 CAGGATGAGGTTCTTGATCTAGG - Intergenic
1154160179 18:11975411-11975433 CAGGAGGACCACTTGAATCTGGG + Intergenic
1155186957 18:23395468-23395490 CTTGCTGAGCTCTTTGATCTTGG - Intronic
1155187850 18:23403011-23403033 CAGGAGAATCACTTGGATCTGGG + Intronic
1155969176 18:32065328-32065350 CAGGAGAATCACTTTAATCTGGG - Intronic
1158952854 18:62511385-62511407 CAGGAGGATCACTTGAATCTGGG + Intergenic
1159044628 18:63357676-63357698 CAGGAGAATCACTTGGATCTGGG - Intronic
1160416600 18:78716362-78716384 CAGGAGGAGCACTTGGACCCAGG + Intergenic
1160939894 19:1615331-1615353 CAGGATGAGCAGTTTGGTCTGGG + Exonic
1161396785 19:4048758-4048780 CAGGAGGATCACTTGTATCTGGG + Intronic
1163800891 19:19364557-19364579 CAGGATAATCACTTGAATCTGGG + Intergenic
1163827421 19:19531506-19531528 CAGGAGGATCACTTCAATCTGGG - Intronic
1164145702 19:22511237-22511259 CAGGATGGGGCCTTTCATCTAGG + Intronic
1164816986 19:31211771-31211793 CAGCATGAGCCCTTTGGCCTGGG + Intergenic
1165594092 19:36997344-36997366 CAGTATGAGCTCTCTGATGTCGG - Intronic
1165666564 19:37635157-37635179 CAGTATGAATACTTTGATGTTGG + Exonic
1166262118 19:41647612-41647634 CAGGAGGAGCACTTGAAGCTAGG - Intronic
1167207768 19:48114006-48114028 CAGGAGGATCACTTGAATCTGGG - Intergenic
1167348176 19:48959731-48959753 CAGGAGGATCACTTAAATCTGGG + Intronic
1167839428 19:52102452-52102474 CAGGAGGATCACTTGAATCTGGG - Intergenic
927062705 2:19439536-19439558 CAAGATGACCACAGTGATCTAGG - Intergenic
927848103 2:26481909-26481931 CACAGTGAGCACTTTGATCCAGG + Intronic
928200087 2:29242294-29242316 TAGGATGAGGACTTTGTCCTGGG - Intronic
929145889 2:38706799-38706821 CAGGAGGAACACTTGAATCTAGG + Intronic
929806908 2:45154125-45154147 CCAGATCAGCACTTTGATTTGGG + Intergenic
930544806 2:52753074-52753096 AAGGATGAGATCTTTGATCTCGG - Intergenic
932042440 2:68315766-68315788 CAGGAGGATCACTTGGATCCAGG - Intronic
932237048 2:70129056-70129078 CAGGATAATCACTTTAACCTGGG - Intergenic
935329733 2:101968180-101968202 CAGGCTGAGCTTTTTGATTTTGG + Intergenic
937425783 2:121797349-121797371 CAAGATGAGCATTTTTAACTGGG - Intergenic
937774661 2:125761967-125761989 CTGGATGAGGACTTTCATTTTGG - Intergenic
937953634 2:127407260-127407282 CAGGATGATCACTTGCACCTGGG + Intergenic
941482781 2:166038431-166038453 CAGGAGGATCACTTTAACCTGGG - Intronic
941935332 2:170977276-170977298 CAGGAGGATCACTTGAATCTGGG + Intergenic
943305629 2:186257971-186257993 CAGGAGGATCACTTGGATCCGGG + Intergenic
944250342 2:197574773-197574795 CAGGAGGATCACTTGAATCTGGG + Intronic
944517097 2:200523207-200523229 CAGGAAGTGCATTTTGAGCTAGG - Intronic
946766087 2:223042354-223042376 CAGGAGAATCACTTGGATCTGGG - Intergenic
946831933 2:223736342-223736364 AAGGTTGTGCACTTGGATCTGGG - Intergenic
948238017 2:236404868-236404890 CAGAATCTGCACCTTGATCTAGG - Intronic
948415885 2:237803172-237803194 CAGGAGAATCACTTTGACCTGGG + Intronic
1169374544 20:5055903-5055925 CAGGATAATCAGTTGGATCTGGG + Intergenic
1170058751 20:12237383-12237405 CAGGAGGCCCACTTTAATCTGGG + Intergenic
1170153829 20:13251819-13251841 GAGGGTGAGCACTTAGAACTTGG + Intronic
1171101964 20:22392929-22392951 TAGGATGAGCACTTTGCTTTTGG - Intergenic
1171317698 20:24209858-24209880 CATGATGAGAACTTTGTCCTGGG + Intergenic
1172038798 20:32029463-32029485 CTGGATCAGCTCTGTGATCTTGG - Intronic
1172266034 20:33615102-33615124 CAGGAGGATCACTTTGGTCCAGG + Intronic
1172970968 20:38872819-38872841 CAGGAGGATCACTTGGGTCTGGG + Intronic
1173291251 20:41717226-41717248 AAGGATGAGCATTATGATCAAGG + Intergenic
1173505433 20:43583426-43583448 CAGGATGCACATTCTGATCTTGG + Intronic
1175786215 20:61713234-61713256 CAGGATGTGCACCTTGAACCTGG - Intronic
1176943421 21:14951397-14951419 GAGGATGAGTTCTTTCATCTAGG - Intergenic
1178847775 21:36187698-36187720 CAGGAGGATCACTTGGAACTAGG - Intronic
1178938133 21:36881908-36881930 CAGGAGGATCACTTGAATCTGGG + Intronic
1178989854 21:37343901-37343923 CAGGATAATCACTTGAATCTGGG - Intergenic
1181314071 22:21960729-21960751 CAGAATAAGCACTGTGACCTTGG - Intronic
1182257796 22:29050681-29050703 GAGGATGTGGACTGTGATCTGGG + Exonic
1184217613 22:43078013-43078035 CAGGAGGATCACTTGAATCTGGG + Intronic
951048537 3:18068188-18068210 GAGGACGTGCTCTTTGATCTGGG - Intronic
952416117 3:33092849-33092871 CAGGATGAGCTCTGTGATCTCGG + Exonic
952873769 3:37924910-37924932 CAGGATGAGAGCTGTGCTCTTGG - Intronic
953048898 3:39322323-39322345 CAGGAGGATCACTTGAATCTGGG + Intergenic
954165068 3:48750268-48750290 CAGGAGAATCACTTTAATCTGGG + Exonic
954819086 3:53309276-53309298 CAGGAGGATCACTTGAATCTGGG + Intronic
954926721 3:54242348-54242370 CAGGATAATCACTTGAATCTGGG + Intronic
955405333 3:58622346-58622368 CAGGAGAATCACTTTAATCTGGG + Intronic
955846902 3:63173283-63173305 CAGGAGAAGCACTTGAATCTGGG + Intergenic
957843704 3:85703264-85703286 CAGGATCAGCACTCTGAACAGGG + Intronic
960544016 3:118891337-118891359 CAGGATCAGCACTGTGAAGTTGG + Intergenic
961074040 3:123964960-123964982 CAGGACTAGCCCTTTGAGCTTGG + Intergenic
961309585 3:125987172-125987194 CAGGACTAGCCCTTTGAGCTTGG - Intergenic
962179781 3:133194027-133194049 CAGGATGATCACTTGAACCTGGG - Intronic
962551415 3:136496049-136496071 CAGGAGAACCACTTGGATCTGGG + Intronic
963502956 3:146151602-146151624 AAGGATGAGAACTTAGATGTAGG + Intronic
963641746 3:147868752-147868774 AATGATGAGCAGTTTGATCTAGG + Intergenic
964405680 3:156346534-156346556 CATGATTTGCACTTTAATCTTGG - Intronic
964724044 3:159795790-159795812 AAGGAAGAGCAGTTTGCTCTGGG + Intronic
965743297 3:171899345-171899367 CAGGAAGATCACTTGAATCTGGG + Intronic
966703783 3:182887909-182887931 AAGAATGAGCACTTTCATCCTGG + Intronic
966858353 3:184212494-184212516 CAGGAGGATCACTTGAATCTGGG - Intronic
967304407 3:188046488-188046510 CAGTACGAGAACTTGGATCTTGG + Intergenic
967327637 3:188258106-188258128 CAGGATGAGCTCTTTGTAGTGGG - Intronic
967424684 3:189313171-189313193 GAGGATGAGTACTTTGATCCAGG + Intronic
967454206 3:189663618-189663640 CAGGAGGATCTCTTTAATCTAGG - Intronic
967738203 3:192976165-192976187 CAGGAGTATCACTTGGATCTGGG + Intergenic
967872155 3:194239267-194239289 CAGGAGGAACACTTGCATCTAGG - Intergenic
968204452 3:196786915-196786937 CAGGAGGATCACTTGAATCTGGG - Intronic
968380534 4:92235-92257 CAGGAGAATCACTTGGATCTGGG + Intergenic
970377860 4:15477207-15477229 CAGGAGAATCACTTTGACCTGGG + Intronic
970592550 4:17572026-17572048 CAGGAGAAGCACTTGAATCTGGG + Intergenic
972435743 4:39033588-39033610 CAGGAGGATCACTTGGATCTGGG - Intergenic
973727920 4:53794334-53794356 CAGGATAACCACTTGGACCTGGG - Intronic
974355886 4:60812252-60812274 CAAGATGGGCTCCTTGATCTTGG - Intergenic
976599069 4:86921070-86921092 CAGGATAATCACTTGAATCTTGG + Intronic
979000034 4:115205958-115205980 CAGGAGGATCACTTGAATCTAGG + Intergenic
980572553 4:134639628-134639650 CTGGATAAGCAGTTTGATGTTGG - Intergenic
983582796 4:169325634-169325656 CACCATGGGCACTTTGTTCTTGG - Intergenic
984322885 4:178215463-178215485 CAGGATCAGCACTTTTTTTTAGG + Intergenic
984436380 4:179715477-179715499 CAGGATGCCCAGTTTTATCTAGG + Intergenic
985511470 5:316369-316391 CAGGATGAGCACATCGGCCTTGG - Intronic
985864102 5:2498657-2498679 CAGGGTCAGCACTTGTATCTGGG - Intergenic
986542472 5:8860779-8860801 CAGGATAATCACTTAAATCTGGG + Intergenic
987539114 5:19230690-19230712 CATGTTGAGGACTTTTATCTTGG - Intergenic
987816846 5:22913220-22913242 CCAGATGAGCACCTTGACCTTGG - Intergenic
987817833 5:22927261-22927283 CAGGAGAATCACTTTAATCTGGG - Intergenic
988709333 5:33757714-33757736 CAGCATGAGCTGTGTGATCTTGG + Intronic
989028285 5:37090899-37090921 TAGGATGTGTACATTGATCTAGG - Intergenic
990626863 5:57623281-57623303 CGGGATGAGCTCTTTTAACTTGG + Intergenic
990959828 5:61382710-61382732 CAGGAGGATCACTTTAATCTGGG + Intronic
991471926 5:66977903-66977925 CAGGATGATCACTGGGTTCTAGG - Intronic
992822289 5:80509444-80509466 AAGTATCAGCACTTTGATATTGG + Intronic
993818430 5:92582885-92582907 CAGGATGAGCTCTTTAATTTTGG + Intergenic
994011867 5:94913965-94913987 CAGGAGGATCACTTGGAGCTAGG - Intronic
996648810 5:125848474-125848496 CATGATGTGAACTGTGATCTTGG - Intergenic
998032316 5:138881392-138881414 CAGGAGAAGCAATTTGACCTTGG - Intronic
998227791 5:140340191-140340213 CAGGAAAATCACTTTAATCTGGG + Intronic
998680278 5:144459442-144459464 CAGGAGAAGCACTTGAATCTGGG - Intronic
999575103 5:152967364-152967386 CATAATGAGCACTTGGGTCTCGG + Intergenic
999716541 5:154365512-154365534 CAACATGAGCTGTTTGATCTTGG + Intronic
1002653853 5:180726093-180726115 CAGGAGGATCACTTTAATCCAGG - Intergenic
1003069351 6:2932476-2932498 CAGGATGCTCACTTTAATCTTGG + Intergenic
1003247684 6:4398235-4398257 CAGGATCAGCCCTCTGAGCTGGG - Intergenic
1004365748 6:15011011-15011033 CAGGATGATCACTTGAATCCGGG + Intergenic
1004899185 6:20178540-20178562 AAGGATGAGATCTTTGAACTTGG - Intronic
1005199701 6:23330105-23330127 CTGGATGAGTACTTTGATCTTGG + Intergenic
1005714161 6:28531276-28531298 CAGGAGAATCACTTGGATCTGGG + Intronic
1006308545 6:33240547-33240569 CAGGATGAGCCCTGCAATCTTGG - Intergenic
1007126061 6:39426656-39426678 CAGGAGGATCACTTGAATCTGGG + Intronic
1007508439 6:42356515-42356537 CTTGCTGAGCACCTTGATCTTGG + Intronic
1008942441 6:57061615-57061637 CAGGATGAGCACTTGAGCCTAGG - Intergenic
1011257939 6:85443008-85443030 CAGGATAATCACTTGGACCTGGG - Intergenic
1011328419 6:86175921-86175943 CAAGATGAGCACATTTTTCTGGG + Intergenic
1013796606 6:113895860-113895882 CAGGATGAGCTCTGTGATCATGG - Intergenic
1015114556 6:129633340-129633362 CAGGAGGATCACTTGAATCTGGG + Intronic
1015408148 6:132860619-132860641 AAGAATGAGGACTGTGATCTGGG - Intergenic
1016192763 6:141291077-141291099 CAGTATGAGCTATGTGATCTGGG - Intergenic
1018248222 6:161842377-161842399 CAGGAGGATCACTTGAATCTGGG + Intronic
1018397585 6:163390530-163390552 CAGGAGAAGCACTTGAATCTGGG + Intergenic
1019950655 7:4369695-4369717 CAGGATGATCACTTGAGTCTAGG - Intergenic
1021311918 7:19107117-19107139 CAGGAACTGCACTTTGATCTAGG - Intronic
1023567157 7:41534741-41534763 CAGGAGGATCACTTGCATCTCGG - Intergenic
1026792630 7:73344675-73344697 CAGGAGGATCACTTGAATCTGGG - Intronic
1028399234 7:90406797-90406819 CTGGATGAGAGCTTTGAGCTAGG - Intronic
1028938493 7:96492500-96492522 CAGGATGATCACTTGGGCCTGGG - Intronic
1029393720 7:100292575-100292597 CAGGAAGATCACTTTAATCCTGG - Intergenic
1032013055 7:128359526-128359548 CAGGAGGAGCACTGTGACCTGGG - Exonic
1033460747 7:141545481-141545503 CAGGGTGAGTACTTTGATCATGG - Intergenic
1034469055 7:151246089-151246111 CAGGATGAGCTGTGTGACCTTGG - Intronic
1034716887 7:153251706-153251728 CAGGATCTTCACTCTGATCTGGG + Intergenic
1034817392 7:154184216-154184238 CAGGATATGCTCTTTAATCTAGG + Intronic
1034946177 7:155263299-155263321 CAGGGTGAGCACTTCCCTCTGGG + Intergenic
1035359314 7:158299862-158299884 CAAAATGAGCACCTTGGTCTGGG + Intronic
1037346486 8:17906586-17906608 CAGGAGAATCACTTGGATCTGGG + Intronic
1038292257 8:26260360-26260382 CAGGAGAAGCACTTGAATCTGGG + Intergenic
1039199351 8:35071419-35071441 CAGGAAGACCACTTAGAGCTAGG + Intergenic
1043453953 8:80395325-80395347 CAGGATGATCACTTGAAGCTAGG + Intergenic
1045173502 8:99696386-99696408 CAGCATGAGCACCACGATCTTGG - Intronic
1048045220 8:130766650-130766672 CAGGATGATCAGTTTGCTTTTGG - Intergenic
1048639594 8:136338833-136338855 CAGGATTAAGAATTTGATCTGGG - Intergenic
1049241666 8:141540481-141540503 CAGGAGGGACACCTTGATCTGGG - Intergenic
1049842879 8:144785339-144785361 CAGGAGGATCACTTGAATCTAGG + Intronic
1050303581 9:4283924-4283946 CAGGAGGAGCACTGTAAGCTAGG + Intronic
1050388380 9:5112641-5112663 CAGGATAAGGAGTTTGGTCTGGG - Intronic
1050735102 9:8752828-8752850 CTGGATCAGCAGTTTGAGCTGGG - Intronic
1050957434 9:11682370-11682392 GAGGATGTGCAGTTTGATTTTGG + Intergenic
1051667132 9:19476024-19476046 CAGGAGGATCACTTGAATCTGGG + Intergenic
1052308194 9:27034885-27034907 CAGGCTGTGCTGTTTGATCTTGG + Intronic
1052368765 9:27641657-27641679 CATGATGACCACTTTGTTCATGG - Intergenic
1052606813 9:30714626-30714648 TAGTATGAGCACCTTGATCTGGG + Intergenic
1052657963 9:31389311-31389333 CACGTTGACCACTTTGAACTAGG + Intergenic
1055898966 9:81212676-81212698 CAGGATTGGCACTTTGAGCTGGG + Intergenic
1055976794 9:81963245-81963267 CAGGAGGATCACTTTAACCTAGG - Intergenic
1057130962 9:92654426-92654448 CAGGATGATCACTTGAGTCTGGG + Intronic
1057346763 9:94258583-94258605 CAGGAGAATCACTTTGAACTCGG - Intergenic
1058658350 9:107246326-107246348 CAGGAGGATCACTTGCATCTAGG - Intergenic
1059418997 9:114179400-114179422 CAGGATGAGGCCGTTGACCTAGG + Intronic
1060607150 9:124925486-124925508 CAGGAGGATCACTTTGGTCTAGG + Intronic
1062129115 9:134883237-134883259 CAGGGTGGGCCCTTTGATCCTGG + Intronic
1203483408 Un_GL000224v1:28822-28844 CAGGATAATCACTTGAATCTGGG + Intergenic
1185625338 X:1477094-1477116 CAGGAGAAGCACTTGGACCTGGG + Intronic
1187202650 X:17150147-17150169 TAGGATGTGCACTTTAATTTAGG + Exonic
1187703525 X:21987422-21987444 CAGGATGATCACTTCAGTCTGGG - Intronic
1188954854 X:36421763-36421785 CAGGAGGATCACTTTAACCTGGG + Intergenic
1189530150 X:41871986-41872008 CAGTATGATCACTTAGATCAGGG + Intronic
1190187574 X:48249478-48249500 CAGGAGGATCACTTGGACCTGGG + Intronic
1190656459 X:52617254-52617276 CAGGAGGATCACTTGGACCTGGG + Intergenic
1192417662 X:70997931-70997953 CAGGAGGATCACTTGAATCTAGG - Intergenic
1192882938 X:75306979-75307001 CAGGAGGATCACTTTAACCTAGG - Intergenic
1194420887 X:93671899-93671921 CTGGATGAGGACTTTGAAATTGG - Exonic
1196122740 X:112067893-112067915 CTTGATGATCACTTAGATCTGGG + Intronic