ID: 1129437894

View in Genome Browser
Species Human (GRCh38)
Location 15:75556990-75557012
Sequence CTATATACCATGATGGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129437894_1129437896 6 Left 1129437894 15:75556990-75557012 CCAAGGTCCATCATGGTATATAG 0: 1
1: 0
2: 0
3: 1
4: 66
Right 1129437896 15:75557019-75557041 TCAAGACTGCCTTCCTTTTAAGG 0: 1
1: 0
2: 1
3: 44
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129437894 Original CRISPR CTATATACCATGATGGACCT TGG (reversed) Intronic
902378720 1:16042594-16042616 CTGAATAACATGATGGCCCTTGG - Intergenic
902697134 1:18147690-18147712 CTACATACCAGGATGGTTCTAGG + Intronic
903239839 1:21975413-21975435 CTATGAACCTTGATGGACGTGGG + Intergenic
903243645 1:22000338-22000360 CTATGAACCTTGATGGACGTGGG + Intergenic
908802486 1:67894750-67894772 ATATACACTATGATGTACCTAGG - Intergenic
911274093 1:95840235-95840257 CAATATACCACCTTGGACCTTGG - Intergenic
916095321 1:161344555-161344577 CTATATTCTATCATGGAACTAGG - Intronic
1063585447 10:7348380-7348402 CTATAATCCATGATGGGCTTTGG + Intronic
1072533705 10:96343606-96343628 CTACATGTCATGAAGGACCTTGG - Exonic
1074797150 10:116958614-116958636 CTAAATGCCAGGATGGACCATGG - Intronic
1075332990 10:121587320-121587342 CAATATACCATCCTGGACATAGG + Intronic
1079892809 11:26079430-26079452 CTATATAACCTGATGGTGCTTGG - Intergenic
1079892987 11:26081122-26081144 CTTTTTAGCATGATGGAACTTGG + Intergenic
1081081730 11:38749462-38749484 CTGTATAACATGATCAACCTTGG + Intergenic
1091809408 12:3382879-3382901 TTATATACCATGTAGGACTTAGG + Intronic
1093509857 12:19913702-19913724 GTATATACCTTGGTGGTCCTAGG + Intergenic
1102003758 12:109575357-109575379 CTATATACCTTGGTAGAGCTTGG + Intronic
1109533986 13:63692756-63692778 CTTTATACCATGAAGGACAGAGG + Intergenic
1111700144 13:91676425-91676447 CAATATACCATCATGGATATAGG + Intronic
1112175601 13:97020485-97020507 CTAAATAACATGTAGGACCTAGG - Intergenic
1119553315 14:75533461-75533483 CTACATAGGATGATGGTCCTAGG + Intronic
1124502039 15:30236868-30236890 CTATATACCTATATGGATCTGGG - Intergenic
1124741525 15:32301784-32301806 CTATATACCTATATGGATCTGGG + Intergenic
1129437894 15:75556990-75557012 CTATATACCATGATGGACCTTGG - Intronic
1132582388 16:690960-690982 CCAGATGTCATGATGGACCTGGG - Intronic
1138239777 16:55418086-55418108 CTATATGCCAGCATGGTCCTAGG + Intronic
1147595241 17:41712518-41712540 CTTTATCCCAGGATGGAACTAGG + Intronic
1149115750 17:53094060-53094082 ATATAAACCATAATGTACCTTGG - Intergenic
1155250781 18:23951462-23951484 CTATAAACCAGGGTGGACCCTGG - Intronic
1165252546 19:34552251-34552273 CTTTAAACAATGTTGGACCTTGG + Intergenic
1168434344 19:56305383-56305405 AGGTATACCATGATGAACCTTGG - Intronic
928442158 2:31301566-31301588 GCATATAGCATGGTGGACCTGGG + Intergenic
929689280 2:44061076-44061098 CAATATACCTTAATGAACCTTGG - Intergenic
1177222515 21:18212920-18212942 CCAAATAACATGATGGACATAGG - Intronic
1177727979 21:24992942-24992964 CTATATACCATGATACACAGTGG + Intergenic
1182544273 22:31064929-31064951 CTAAATGCAATGTTGGACCTTGG - Intronic
960483839 3:118226830-118226852 ATATATACCATGCTGGGACTGGG + Intergenic
960644578 3:119865084-119865106 CTGTATATGATTATGGACCTTGG - Intronic
977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG + Intronic
978050515 4:104193741-104193763 CTATATACCAATATTGATCTAGG - Intergenic
978470750 4:109064836-109064858 GTATTTACTTTGATGGACCTAGG - Intronic
990722118 5:58708305-58708327 CTATGAACGATGATGGATCTGGG + Intronic
991474985 5:67009958-67009980 AAATATTCCATGATGGCCCTGGG + Intronic
995000650 5:107123678-107123700 GTATATAGCCTGTTGGACCTAGG + Intergenic
998052437 5:139047090-139047112 CACTATACCATATTGGACCTTGG + Intronic
1004143846 6:13046612-13046634 ATATACACCATGAAGGAGCTGGG - Intronic
1008909200 6:56715240-56715262 ATAGATGCCATGATGGGCCTTGG - Intronic
1009402127 6:63269505-63269527 CTTTATCCAATGATGGACCTAGG - Intergenic
1011250968 6:85371722-85371744 CTATCTCCCACGAGGGACCTTGG - Intergenic
1013819558 6:114138197-114138219 CTATATGCCATGATAGTTCTAGG + Intronic
1013851770 6:114524805-114524827 ATATATACCATGATTTATCTAGG + Intergenic
1025790159 7:64681181-64681203 CCATGGACCATCATGGACCTCGG + Intronic
1026171078 7:67954467-67954489 CTATAAACCATGGAGGTCCTGGG - Intergenic
1027542892 7:79490542-79490564 TTATGTACCATTATAGACCTGGG - Intergenic
1033845120 7:145422399-145422421 CTATACACCATGCTGGGCATGGG - Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1045896079 8:107218603-107218625 TTGTTTACCATGATAGACCTAGG - Intergenic
1046468039 8:114632366-114632388 CTATATACCATTCAGGACATAGG - Intergenic
1047172645 8:122508922-122508944 CTATATGTCATCATGGACCCAGG - Intergenic
1048565559 8:135593082-135593104 CTATCTACCAGGAGGGACCAAGG - Intronic
1049335715 8:142083655-142083677 CTGTATTCCATGCTGGACCCCGG - Intergenic
1185643077 X:1599049-1599071 CTTTATCCCAAGGTGGACCTCGG - Intronic
1189966927 X:46382976-46382998 ATAAATACCATGATGGTCTTGGG + Intergenic
1191164463 X:57373085-57373107 TGATATACCATGATATACCTTGG - Intronic
1195523582 X:105859371-105859393 CCATGTTCTATGATGGACCTTGG + Intronic
1196524647 X:116718224-116718246 GGAAATACCATGATGGACATAGG + Intergenic
1198629346 X:138617564-138617586 CTCTTTACCATGATGATCCTTGG - Intergenic
1199448255 X:147952141-147952163 CTATGTACCATAATGAAACTGGG + Intergenic