ID: 1129440751

View in Genome Browser
Species Human (GRCh38)
Location 15:75579292-75579314
Sequence TCGCGGGCGGCCGCAGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129440741_1129440751 12 Left 1129440741 15:75579257-75579279 CCCTGCGACCTGCGCGGCTGCCT 0: 1
1: 0
2: 0
3: 13
4: 88
Right 1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG 0: 1
1: 0
2: 1
3: 1
4: 39
1129440747_1129440751 -8 Left 1129440747 15:75579277-75579299 CCTCAGCCAGGCTCCTCGCGGGC 0: 1
1: 0
2: 0
3: 15
4: 252
Right 1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG 0: 1
1: 0
2: 1
3: 1
4: 39
1129440743_1129440751 4 Left 1129440743 15:75579265-75579287 CCTGCGCGGCTGCCTCAGCCAGG 0: 1
1: 0
2: 3
3: 25
4: 255
Right 1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG 0: 1
1: 0
2: 1
3: 1
4: 39
1129440742_1129440751 11 Left 1129440742 15:75579258-75579280 CCTGCGACCTGCGCGGCTGCCTC 0: 1
1: 0
2: 1
3: 16
4: 177
Right 1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG 0: 1
1: 0
2: 1
3: 1
4: 39
1129440739_1129440751 27 Left 1129440739 15:75579242-75579264 CCTCGCGGACGCTGGCCCTGCGA 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG 0: 1
1: 0
2: 1
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129440751 Original CRISPR TCGCGGGCGGCCGCAGCGAA AGG Intergenic
900171924 1:1273534-1273556 CCGCGGGCGGCGGGCGCGAACGG + Intronic
900195806 1:1374981-1375003 TCGCGCTCGGACGCACCGAAAGG + Exonic
906556623 1:46719116-46719138 GCGCAGGCGGCCGCTGCCAAAGG - Intergenic
912576223 1:110674867-110674889 TCGGGGGCGGAGGCGGCGAAAGG - Exonic
914237314 1:145823879-145823901 TCTCGGACGGCCGCGGCGGAGGG - Exonic
915313908 1:155017585-155017607 CCCCGGGCTGGCGCAGCGAAGGG + Exonic
1075522832 10:123154426-123154448 GCGGCGGCGGCCGCAGCGAGTGG + Exonic
1089876000 11:121722770-121722792 TGGGGGGCGGCCGGAGAGAAGGG + Intergenic
1092193265 12:6534886-6534908 TCGGGGGCGGTCGCAGCCCAGGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092521800 12:9283678-9283700 TGGCGGGTGGCCTCAGTGAAAGG - Intergenic
1103562689 12:121800537-121800559 GCGCGGGCGCCCGCAGCCGAGGG - Intronic
1104894923 12:132159394-132159416 CCCCGGGGGGCCACAGCGAACGG - Intergenic
1115235772 14:31207585-31207607 TCGCGTGCGGCAGCAGCCAGCGG + Intronic
1125916591 15:43493192-43493214 TGGCGGGCGGCGGCAGCGAATGG - Intronic
1128269200 15:66293773-66293795 GAGCGGGCGGCCGCAGTGAGGGG + Intronic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129440751 15:75579292-75579314 TCGCGGGCGGCCGCAGCGAAAGG + Intergenic
1147264364 17:39225849-39225871 TGGGGGGCGGGCGCAGCGGACGG - Exonic
1153480563 18:5543321-5543343 GCGCGGGCGGGCGCAGCGCGGGG - Intronic
1159539846 18:69761213-69761235 TCGCAGCCGGCCCCAGGGAAAGG - Intronic
1159539860 18:69761313-69761335 TCGCAGCCGGCCCCAGGGAAAGG - Intronic
1161400244 19:4064129-4064151 CCGCGGGCGGCCGCAGGCAGTGG - Intronic
1163700005 19:18782191-18782213 TTGTGGGCGGCCGCAGCGGGCGG + Exonic
1166888257 19:45973957-45973979 GCGCGGGCGGCGGCGGCGACGGG + Intergenic
1169131432 20:3168085-3168107 TCGCGGGTGGGCGCCGCCAAGGG + Intronic
1175824781 20:61930971-61930993 TCGAGGGCAGCCGCAGTGGAGGG + Intronic
1176139081 20:63537314-63537336 TGGCGGGCGGGCGCAGCGGCAGG + Exonic
1181813768 22:25421370-25421392 TCGCTGGCGGCCGCAGGGGGCGG - Intergenic
1182355558 22:29720910-29720932 CCGCGGGCGGGCGCCGCGGAGGG - Intronic
1184671446 22:46014025-46014047 CCGCCGGCTGCCGCAGGGAAGGG - Intergenic
961176895 3:124843000-124843022 TCGGGGCCGGCGGCAGCGATGGG + Intronic
964339035 3:155688779-155688801 TAGCGGGTGGCCACAGAGAAAGG + Intronic
985504658 5:271964-271986 TCGGGGGCGGCGGCAGGGGACGG - Intronic
986402853 5:7396226-7396248 ACGCGGGCGGCCGCGGCGAGCGG + Exonic
987258178 5:16179226-16179248 CCGGAGGCGGCAGCAGCGAAAGG - Exonic
992502355 5:77355388-77355410 TCGAAGGAGGCTGCAGCGAATGG + Intronic
1002721133 5:181261892-181261914 ACGCAGGCGGCAGCACCGAAGGG - Intergenic
1007584220 6:42978925-42978947 TCCCGGGCCGCCGCAGCTACTGG - Exonic
1024594159 7:50918062-50918084 TCCCTGGCGGCTGCAGAGAAGGG - Intergenic
1029178981 7:98685730-98685752 TCTCGGGCAGCTGCAGGGAAGGG + Intergenic
1031689095 7:124765898-124765920 TCGCGGGCGCGCGCAGCGGCTGG - Intergenic