ID: 1129443263

View in Genome Browser
Species Human (GRCh38)
Location 15:75598015-75598037
Sequence GTAGCCCAGGGGACTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129443257_1129443263 3 Left 1129443257 15:75597989-75598011 CCAAGACTTGAACAGCCATGGTT 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1129443263 15:75598015-75598037 GTAGCCCAGGGGACTGAGATGGG 0: 1
1: 0
2: 0
3: 12
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129443263 Original CRISPR GTAGCCCAGGGGACTGAGAT GGG Intergenic
900279360 1:1856131-1856153 GCTGCTCAGGAGACTGAGATGGG - Intronic
901502688 1:9663212-9663234 GTAGCCCTGGGGACTACGACTGG - Intronic
901769182 1:11521799-11521821 CTGGCCCAGTGGACTGGGATAGG + Intronic
902112821 1:14097230-14097252 ATAGTCCAGGGAACTTAGATAGG + Intergenic
903014268 1:20351698-20351720 GTAGTCCAGGAGACTGAGGTGGG + Intronic
903229249 1:21911791-21911813 GCAGCTGAGGGGGCTGAGATGGG - Intronic
903393270 1:22980100-22980122 GTTGCCCAGAAGACTGAGGTGGG - Intergenic
903781391 1:25822268-25822290 GTAGCTCATGAGACTGAGATTGG + Intronic
905215225 1:36401843-36401865 GGAGGCCAGGGGACTGAGGGTGG - Intergenic
906415504 1:45618725-45618747 GTAGCCAAGGGGACTGATGGTGG + Exonic
906642398 1:47449375-47449397 GTCTCCCGGGGCACTGAGATAGG + Intergenic
907158250 1:52353674-52353696 GTAACTAAGGGGACAGAGATGGG + Intronic
907729255 1:57049968-57049990 GGAGCCCAGAGGACAGAGAAAGG - Intronic
910758311 1:90713135-90713157 CCAGCCCTGGGGACTGAGAGGGG - Intronic
911313227 1:96323446-96323468 GCTTCCCAAGGGACTGAGATGGG + Intergenic
915115871 1:153599124-153599146 GTGGTCCTGGGGACAGAGATGGG + Intergenic
916246778 1:162696408-162696430 GGAGCCCAGAGGCCTGAGAGGGG - Intronic
922323181 1:224505185-224505207 GTAGTCCAGGAGGCTGAGGTGGG + Intronic
924762009 1:246996242-246996264 GCAACCCAGGAGGCTGAGATGGG + Intronic
1063366968 10:5496813-5496835 GTAGCCCGGGGCACTGAGGCGGG - Intergenic
1063582801 10:7324512-7324534 GTAACTCAGGGAACTCAGATTGG - Intronic
1064189950 10:13197035-13197057 GCTACTCAGGGGACTGAGATGGG - Intronic
1066155425 10:32671826-32671848 GTAGCTCTGGGAACTGAGGTTGG + Intronic
1067286474 10:44911198-44911220 GCAGCCCAGCCGCCTGAGATCGG - Exonic
1067733379 10:48830167-48830189 GAATTCCAGGGGACTGAAATGGG + Intronic
1067850431 10:49750778-49750800 CCAGCCCAGGGGACAGAGGTGGG - Intronic
1069481381 10:68785330-68785352 GTTGCGCAGAGGGCTGAGATGGG - Intronic
1070161419 10:73868833-73868855 CTGGCCCTGGGGACTGAAATGGG - Intronic
1070848452 10:79543053-79543075 CTACCCCTGGGGACTGTGATGGG + Intergenic
1072674490 10:97455389-97455411 GCAACTCAGGAGACTGAGATAGG - Intronic
1076148429 10:128143676-128143698 GAAGCCCAGGGGGCTGAGCATGG - Intergenic
1076150595 10:128159263-128159285 GTGGCCCAGGGGAGTGAGGGGGG + Intergenic
1078353902 11:10619002-10619024 TTAGCCAAGGGGACTGATAATGG + Intronic
1079480240 11:20872290-20872312 GTAACCCAGGAGGCTGAGGTGGG - Intronic
1079673990 11:23202444-23202466 GGAGGCCAGGGGGCTGAGAGTGG + Intergenic
1081992287 11:47344333-47344355 CTGGCCCTGGGGGCTGAGATGGG - Intronic
1083791223 11:64987392-64987414 GTAGTCCAGGAGACTGAGTCAGG + Intergenic
1083888188 11:65582920-65582942 GTAGCCCAGGAGATAGAGGTGGG + Exonic
1087059846 11:93966812-93966834 GCAACTCAGGAGACTGAGATGGG + Intergenic
1087858562 11:103124331-103124353 GTTACTCAGGAGACTGAGATGGG + Intronic
1089457211 11:118632609-118632631 ACAGCCCAAGGGACTGACATTGG + Intronic
1091768905 12:3138965-3138987 GTAGCCCTGGGCTCTGAGCTGGG - Intronic
1094761567 12:33539362-33539384 GTAGTCCAGGAGGCTGAGGTGGG - Intergenic
1098832813 12:75383319-75383341 TAAGCCCAGGTGACTAAGATAGG - Intronic
1099418784 12:82426700-82426722 GGAGCCCATGGGGCTGTGATTGG - Intronic
1102495272 12:113315172-113315194 GCTGCCCAGGGGGCTTAGATGGG + Intronic
1102997418 12:117361076-117361098 GGAGCCCTGGGGACGGAGAAGGG + Intronic
1103134057 12:118492379-118492401 GTAGCCCAGAGATGTGAGATTGG + Intergenic
1103349112 12:120271009-120271031 GTTACCCAGGAGACAGAGATGGG - Intergenic
1104921933 12:132295129-132295151 ACAGCCCAGGGGCCAGAGATGGG + Intronic
1108091452 13:46854036-46854058 CTAGCCCAAGTGACTGAGCTGGG + Intronic
1108161650 13:47646174-47646196 GTAACAGAGGGGACTGTGATGGG - Intergenic
1109253768 13:60052344-60052366 CTGTCCCAGGTGACTGAGATTGG + Intronic
1115209004 14:30945825-30945847 GTAGCCCAGGGTTGGGAGATAGG + Intronic
1115822522 14:37226690-37226712 GTAACTCAGGAGGCTGAGATGGG + Intronic
1116879347 14:50148997-50149019 GTTGCCCAGGAGGCTGAGGTGGG - Intronic
1117661768 14:58013910-58013932 GCAGCTCAGGAGACTGAGGTAGG + Intronic
1119655596 14:76414497-76414519 GCAACACAGGGGACTGAGCTGGG - Intronic
1119793581 14:77376504-77376526 CTGGGGCAGGGGACTGAGATGGG + Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1125491569 15:40152618-40152640 GCTGCCCAGGAGACTGAGGTGGG - Intergenic
1126741384 15:51779790-51779812 GCTGCTCAGGGGACTGAGGTGGG - Intronic
1129384313 15:75187491-75187513 CCAGCTCAGGAGACTGAGATGGG - Intergenic
1129443263 15:75598015-75598037 GTAGCCCAGGGGACTGAGATGGG + Intergenic
1129481169 15:75827686-75827708 GTAGCCCAGGGGAGCGTGCTGGG + Intergenic
1130990326 15:88872111-88872133 GTGGCCCAGGGGACAGGGAGTGG + Intronic
1132568922 16:635618-635640 GCAGCGCAGGGGGCTGACATGGG + Exonic
1132607747 16:800579-800601 TGAGCCCAGGGGACTGACCTGGG + Intronic
1133528227 16:6627218-6627240 CCAGCACAGGGGAATGAGATGGG + Intronic
1134493248 16:14711933-14711955 GGAGCGTGGGGGACTGAGATGGG + Intronic
1134498629 16:14751057-14751079 GGAGCGTGGGGGACTGAGATGGG + Intronic
1134525183 16:14937687-14937709 GGAGCGTGGGGGACTGAGATGGG + Intronic
1134547712 16:15123232-15123254 GGAGCGTGGGGGACTGAGATGGG - Intronic
1134581945 16:15378028-15378050 GGAGCGTGGGGGACTGAGATGGG - Intronic
1134720635 16:16379489-16379511 GGAGCGTGGGGGACTGAGATGGG + Intronic
1134878836 16:17726467-17726489 GCAACTCAGGGGGCTGAGATAGG + Intergenic
1134946792 16:18332396-18332418 GGAGCGTGGGGGACTGAGATGGG - Intronic
1136998611 16:35208464-35208486 GTCGCCAAGGGGACTGAGTCAGG + Intergenic
1137443885 16:48520222-48520244 GTAGTCCAGGGAGCCGAGATGGG - Intergenic
1139857231 16:69990538-69990560 GGAGCGTGGGGGACTGAGATGGG - Intergenic
1140551141 16:75867222-75867244 TTAGCACAGGGTACTGAGAAAGG - Intergenic
1141495435 16:84406518-84406540 GCTGCCCAGGGGACTGTGATTGG - Intronic
1143837271 17:9702255-9702277 GTTGCTCAGGAGGCTGAGATAGG + Intronic
1144662364 17:17079515-17079537 GTAGCCCTGGGGTCAGAGCTGGG + Intronic
1146261561 17:31425562-31425584 GTGACCCAGGGGACTGAGTGGGG + Intronic
1146686379 17:34844235-34844257 GAAGCTCAAGGGACTGGGATGGG + Intergenic
1147139217 17:38452166-38452188 GGAGCCTAGGGGACGGAGGTGGG - Intronic
1147156994 17:38549012-38549034 GAGGGCCAGGGGACTGAGTTAGG - Intronic
1147605070 17:41769757-41769779 GTAGCCCAGAGGACCCAGGTGGG - Intronic
1147906841 17:43829021-43829043 GAAGCCCAGAGAATTGAGATTGG - Intronic
1148569523 17:48657071-48657093 GAAGCCAAGGGGTCTGAGAGAGG + Intergenic
1149946081 17:60929171-60929193 GTGACCCAGGAGGCTGAGATGGG + Intronic
1150088934 17:62302770-62302792 GTCACTCAGGAGACTGAGATGGG + Intergenic
1150919986 17:69472619-69472641 GTAGCTCAGAGTACTGAGCTGGG - Intronic
1155138925 18:23025141-23025163 GTAACTCAGGAGGCTGAGATGGG + Intronic
1155307121 18:24489369-24489391 GTTGCTCGGGGGGCTGAGATGGG - Intergenic
1157416873 18:47510776-47510798 GTGGCCTAGAGGACTGAGAGTGG - Intergenic
1157706741 18:49813693-49813715 GGAGCCCAGGGGACGGGGCTCGG + Exonic
1160767339 19:814321-814343 CTGGCCCAGGGGTCTGAGGTGGG - Intronic
1162958191 19:14111538-14111560 CTAGCCCAGGGGCCTGAGCCTGG + Intronic
1164893757 19:31849983-31850005 GTTGCCCAGGAGGCTGAGGTGGG + Intergenic
1166875476 19:45894523-45894545 GAAGCTCAGGAGGCTGAGATGGG - Intronic
1166989981 19:46686387-46686409 CTAACTCAGGAGACTGAGATGGG + Intronic
1167445910 19:49537380-49537402 AGACCCCAGGGGACTGAGAGTGG - Intronic
1168031895 19:53686797-53686819 GCAACACAGGAGACTGAGATGGG - Intergenic
1168043821 19:53779785-53779807 GTTGCTCAGGGGGCTGAGGTGGG + Intergenic
1168276507 19:55281563-55281585 TTTGCCCATGTGACTGAGATAGG - Intergenic
926657616 2:15425929-15425951 GTAGCAAAGGTGACTGAGAAGGG - Intronic
927356286 2:22177412-22177434 GTAGGGCAGGGGACAGAGAAGGG + Intergenic
927857615 2:26537271-26537293 GCAGCCCCGGGCACTGAGGTAGG - Intronic
928208340 2:29304057-29304079 GTAGGCCAAGGGACAGACATAGG - Intronic
929505715 2:42526309-42526331 GTTACCCAGGAGGCTGAGATGGG - Intronic
929573802 2:43039816-43039838 CCAGCCCAGGGGACTCAGGTGGG + Intergenic
930700452 2:54455289-54455311 GTAGACCAGGTGACTGGGAAGGG + Intergenic
930821223 2:55649595-55649617 ATAGCCCTGCGGAATGAGATGGG - Intronic
930951185 2:57145912-57145934 CTACCACTGGGGACTGAGATTGG + Intergenic
932014711 2:68013042-68013064 GTGGCCCAGGAGGCAGAGATGGG - Intergenic
933392099 2:81683869-81683891 GTTACTCAGGAGACTGAGATGGG - Intergenic
935202616 2:100871033-100871055 GTTGCCCAGGGCAGTGTGATGGG - Intronic
935693901 2:105754056-105754078 GGAGCAGATGGGACTGAGATAGG + Intronic
936610956 2:114001516-114001538 GTAGCTCAGGAGGCTGAGATGGG - Intergenic
938481430 2:131665336-131665358 GTTGCTCAGGAGACTGAGGTGGG + Intergenic
939084997 2:137708246-137708268 GGAGCCCAGGGGGCTGAGGGTGG - Intergenic
941683099 2:168420261-168420283 GCAGCCCACAGAACTGAGATAGG + Intergenic
942805211 2:179922789-179922811 GCAACCCAGGGGGCTGAGGTGGG + Intergenic
943063757 2:183065375-183065397 GGAGCTCAGGAGACTGAGACGGG + Intergenic
943325937 2:186498098-186498120 GTAGCACAATGGACAGAGATGGG - Intronic
1169066298 20:2695949-2695971 GTGGCTGAGGGCACTGAGATTGG - Intronic
1170828705 20:19820716-19820738 GCTCCCCAGGGGACTCAGATGGG - Intergenic
1171172171 20:23025067-23025089 GTAGCACATGAAACTGAGATCGG - Intergenic
1172355483 20:34276890-34276912 CTAGCCCAGGGGACCGAGCTAGG - Intergenic
1172644266 20:36460339-36460361 GTAGCATAAGTGACTGAGATAGG + Intronic
1172658229 20:36549669-36549691 GTAGGGAAGGGGACTGAGAGGGG - Exonic
1173409073 20:42793762-42793784 GTAGGCCAGTGGACAGATATGGG - Intronic
1173801461 20:45897158-45897180 GAAGCCCAGGGTCCTGTGATTGG + Intronic
1177508909 21:22057317-22057339 CTACCCCAGGAGGCTGAGATGGG - Intergenic
1177678942 21:24338929-24338951 GTAGCCAAGGGGTCTGGGAGAGG - Intergenic
1178347655 21:31845405-31845427 GGAGGCCAGTGGTCTGAGATCGG - Intergenic
1179388716 21:40967888-40967910 GCAGCACTGGGGACTGAGACCGG + Intergenic
1179723409 21:43328780-43328802 GTGACCCCGGGGACAGAGATGGG + Intergenic
1180009935 21:45042902-45042924 GTAGCCCTGGGGGGTGGGATGGG - Intergenic
1182852042 22:33483602-33483624 GTAGCCAAGGGGAACGAAATAGG + Intronic
1183574334 22:38677600-38677622 GGAGCCCAGGTGACTGCCATCGG - Intergenic
950269454 3:11602067-11602089 GGAGCCTGGGGGACTGAGATGGG - Intronic
950654179 3:14426417-14426439 GCAGCCCAGGGAGCTGGGATTGG + Intronic
950668513 3:14511538-14511560 GAAGCCCAGGGGTCTGAGTGTGG + Intronic
950735969 3:15008408-15008430 GTTACTCAGGAGACTGAGATGGG + Intronic
954173702 3:48826046-48826068 GGAGCCCAGGAGTTTGAGATCGG + Intronic
954687641 3:52379293-52379315 GTAGCCCAGGCTAAGGAGATGGG + Intronic
962479323 3:135785287-135785309 GTAGCACTGAGGACTGAGAGGGG - Intergenic
964388306 3:156172749-156172771 GTAGGCTAAAGGACTGAGATAGG + Intronic
966882198 3:184356917-184356939 GTAGGTCAGGGGACAGTGATGGG - Intronic
969066696 4:4488432-4488454 GGACCCCAGGAGAATGAGATTGG - Intronic
969106418 4:4810323-4810345 GAGGCCCAGGGGCCTGAAATAGG + Intergenic
969890259 4:10253587-10253609 GTATCTCAATGGACTGAGATTGG + Intergenic
972892361 4:43574640-43574662 GTAGCTCAGATGTCTGAGATAGG - Intergenic
973712460 4:53643260-53643282 GCTGCCCAGGAGACTGAGGTGGG - Intronic
975211643 4:71707342-71707364 GTAGCTCAGGGGCCTGACACAGG - Intergenic
977209324 4:94200046-94200068 GCTACTCAGGGGACTGAGATGGG + Intergenic
980028132 4:127790987-127791009 GTTGCTCAGGAGGCTGAGATAGG + Intronic
980400551 4:132278684-132278706 GCAACCCAGGTGGCTGAGATGGG - Intergenic
981174898 4:141669669-141669691 GTATCCCAGGGGACAGGGATTGG + Intronic
984383546 4:179027214-179027236 GTTGCTCAGGAGACTGAGGTGGG - Intergenic
985684428 5:1274306-1274328 ATAGCCCATGGGTCTGAGGTCGG + Intronic
986457920 5:7938947-7938969 CTAGCCCAGGGGAGAGAGATGGG + Intergenic
987140942 5:14945606-14945628 GAAGCCCAGGTGAGTGACATGGG - Intergenic
987322810 5:16786002-16786024 GGAGCCCAGAGGACTGTGAAGGG - Intronic
989949340 5:50279357-50279379 TAAGCCCAGGGGACAGAAATTGG + Intergenic
992692144 5:79251341-79251363 GTAACTCAGGAGCCTGAGATGGG - Intronic
992792741 5:80228118-80228140 GCTGCCCAGGAGACTGAGATGGG + Intronic
993820924 5:92615591-92615613 GGAACCCAGGGGGCTGAGCTGGG + Intergenic
994702845 5:103158815-103158837 GCAGCTCAGGAGGCTGAGATGGG + Intronic
996160577 5:120157374-120157396 GTAGCTCAGGGGAAAGAGGTTGG - Intergenic
997269950 5:132528027-132528049 GCTACCCAGGAGACTGAGATGGG + Intergenic
997611963 5:135221725-135221747 GTAGCCCAGGGGAGAAAGAGGGG - Intronic
997874242 5:137534332-137534354 GAAGATCAGGGCACTGAGATGGG - Intronic
998997937 5:147886934-147886956 GTATCTCAGGTGACTGAGGTCGG + Intronic
999126239 5:149248176-149248198 TTAGCCCAGGGGATTGAGACGGG - Intronic
999134872 5:149311912-149311934 TCAGCCCAGGGGACAGATATGGG + Intronic
999164352 5:149535311-149535333 CTAGGCCAGGGAACTGGGATTGG - Intronic
999780597 5:154847073-154847095 GTTACTCAGGGGACTGAGGTGGG - Intronic
1002279767 5:178123472-178123494 GTAGCCAAAGGGAGTGAGGTGGG - Exonic
1002588613 5:180270737-180270759 GTTACTCAGGGGACTGAGGTGGG + Intronic
1002706210 5:181162094-181162116 GTGGCCCATGTGACAGAGATGGG - Intergenic
1002845001 6:938248-938270 GTAGATAAGGGAACTGAGATGGG + Intergenic
1007364514 6:41381915-41381937 GTACCTCAAGGGATTGAGATGGG - Intergenic
1007600827 6:43079947-43079969 GCTGCCCAGGAGACTGAGGTGGG + Intronic
1008318655 6:50079425-50079447 GCTGCTCAGGGGACTGAGGTGGG - Intergenic
1008642830 6:53482450-53482472 GTTGCTCAGGAGGCTGAGATGGG + Intergenic
1008938569 6:57019985-57020007 GTAACCCAGGAGCCTGAGGTGGG + Intronic
1011032663 6:82940530-82940552 GCATCCCAGGAAACTGAGATGGG - Intronic
1011961976 6:93102002-93102024 GCTGCTCAGGAGACTGAGATGGG + Intergenic
1013147034 6:107403832-107403854 CTAGGCCATGGGACTGTGATGGG + Intronic
1013175535 6:107673482-107673504 GTTCCCCAGGGCACTGAGTTCGG - Intergenic
1015748729 6:136538678-136538700 CTACCTCAGGGGGCTGAGATGGG + Intronic
1019375334 7:688291-688313 GTTACCCAGGGGGCTGAGACAGG + Intronic
1021863615 7:24932324-24932346 TGCGCCCAGGGGTCTGAGATAGG + Intronic
1023685494 7:42730290-42730312 GCTGCCCAGGAGACTGAGGTGGG + Intergenic
1023893670 7:44413941-44413963 GCTGCTCAGGAGACTGAGATGGG + Intronic
1025184346 7:56845531-56845553 TTAGCCCAGGAGTTTGAGATCGG + Intergenic
1025687582 7:63731437-63731459 TTAGCCCAGGAGTTTGAGATCGG - Intergenic
1028598253 7:92570426-92570448 GAAGGAGAGGGGACTGAGATTGG + Intronic
1029688198 7:102163382-102163404 CTAACCCAGGAGGCTGAGATGGG + Intronic
1030661412 7:112223284-112223306 CTGGCCCAGGGGACTCAGAATGG + Intronic
1031611819 7:123836914-123836936 GTTACTCAGGGGACTGAGACAGG + Intronic
1032501567 7:132403884-132403906 GCTGCCCTGGGGACTGAGAAGGG - Intronic
1032727209 7:134601626-134601648 CTACCCCAGGGGGCTGAGGTGGG + Intergenic
1033545822 7:142399258-142399280 GTCACTCAGGGGACTTAGATGGG + Intergenic
1035934298 8:3819696-3819718 GTTCCCCAGGAGGCTGAGATTGG - Intronic
1036357377 8:8054977-8054999 GTTACCCAGGAGACTGAGGTGGG - Intergenic
1037744439 8:21631582-21631604 GTCTCCCAGGAGACTGAGGTGGG + Intergenic
1037814009 8:22102496-22102518 GAATCACAGGGGACTCAGATGGG - Intronic
1037814211 8:22103323-22103345 GGAGCCCAGGCCAGTGAGATGGG + Exonic
1038289434 8:26235699-26235721 GCTACCCAGGAGACTGAGATGGG - Intergenic
1038999309 8:32962222-32962244 GGAGCCTAGGGGAATGAGATTGG + Intergenic
1041011291 8:53546723-53546745 GAAGCACAGGCAACTGAGATTGG - Intergenic
1041105177 8:54435683-54435705 GTAGCCCAGGGAAAAGAGAGGGG + Intergenic
1041746340 8:61212445-61212467 GGAGCCCAGGGTACTGAGGCTGG + Intronic
1043738445 8:83775967-83775989 GCAGCCCAGGAGTCTGAGCTGGG + Intergenic
1044265358 8:90175307-90175329 AGAGCACAGGAGACTGAGATCGG - Intergenic
1045109462 8:98926482-98926504 TTAGCCCAGGGCACTAATATGGG - Intronic
1046773589 8:118140381-118140403 GTTGCTCAGGAGACTGAGGTGGG - Intergenic
1047231243 8:123000165-123000187 GTAGTCCAGGAGGCTGAGGTGGG + Intergenic
1047318130 8:123753340-123753362 GTACCCCAGTGGACTGAGCATGG + Intergenic
1047512941 8:125529396-125529418 GTAACCGAGGAGGCTGAGATGGG - Intergenic
1049878090 8:145040492-145040514 GTTACTCAGGAGACTGAGATGGG - Intergenic
1050033881 9:1414706-1414728 ATAGCCAAGAGGCCTGAGATTGG - Intergenic
1052299547 9:26938259-26938281 GCACCTCAGGAGACTGAGATAGG + Intronic
1052403667 9:28032336-28032358 ATAGCCCTGGAGACTGAGGTGGG - Intronic
1053388417 9:37714756-37714778 GTTACTCAGGGGACTGAGGTGGG - Intronic
1055932636 9:81575267-81575289 GCTACCCAGGGGGCTGAGATGGG + Intergenic
1056277523 9:85007533-85007555 GTAGCCCAGGGGACAGGGGGAGG + Intronic
1058913966 9:109547577-109547599 GCTACCCAGGAGACTGAGATGGG - Intergenic
1059154203 9:111975624-111975646 GGAGCCCAGTGGTCTGTGATAGG - Intergenic
1059927985 9:119230886-119230908 GTAGGCCAGGGAAGGGAGATGGG - Intronic
1060470831 9:123946817-123946839 GTAGCTCAGGAGGCTGAGGTGGG + Intergenic
1203786212 EBV:129330-129352 CTAGCCCTGGGGACAGAGAGCGG - Intergenic
1185557168 X:1030551-1030573 CTACTCCAGGGGACTGAGGTGGG + Intergenic
1186367494 X:8910787-8910809 ATAGCTCAGGGGAATGAGACTGG + Intergenic
1186422190 X:9435237-9435259 GTTACTCAGGAGACTGAGATGGG - Intergenic
1190457353 X:50639148-50639170 GTATGCCAGGGGACAGCGATGGG - Intronic
1191253647 X:58270695-58270717 GTACCCCAGGGGACGGGGACAGG - Intergenic
1191254877 X:58275348-58275370 GTCCCCCGGGGGACGGAGATAGG - Intergenic
1192060314 X:67817454-67817476 GTAGCTCAGAGGAGAGAGATAGG + Intergenic
1192428850 X:71099286-71099308 GTGGCCCAGGGAGCTGAGATTGG - Intronic
1194957380 X:100196860-100196882 GTAGCCTAAAGGACTAAGATAGG + Intergenic
1195969575 X:110458586-110458608 GTAGTCCAGTGGACTGAGCCTGG - Intergenic
1196710740 X:118759486-118759508 GTAGGCCAAGGGAGTGAGGTTGG + Intronic
1201799173 Y:17935869-17935891 GTAGCAAAGGAGACTGAGAAAGG + Intergenic
1201802380 Y:17970087-17970109 GTAGCAAAGGAGACTGAGAAAGG - Intergenic