ID: 1129446785

View in Genome Browser
Species Human (GRCh38)
Location 15:75624718-75624740
Sequence CCCGCCAAGAACAGCCTTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129446785 Original CRISPR CCCGCCAAGAACAGCCTTGA AGG (reversed) Exonic
900594002 1:3472259-3472281 CCAGCCAAGCCCAGCCTTGGTGG + Intronic
902037920 1:13471062-13471084 CCTGGCAAGAACAGCGTGGAGGG - Intergenic
902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG + Intronic
909493195 1:76248034-76248056 CCAGCCAAGAGAAGCCATGAAGG - Intronic
911167129 1:94734343-94734365 CCCACAAAGAACAGCTTTGCAGG - Intergenic
912620523 1:111151787-111151809 CCCACAAAGAACAGCTTTGCAGG + Intronic
915208651 1:154289598-154289620 CCCACAAAGAACAGCTTTGCAGG + Intergenic
916359480 1:163952450-163952472 CTAGCCAAGGAAAGCCTTGAGGG + Intergenic
1062876364 10:945943-945965 CTCAGCAGGAACAGCCTTGATGG + Intergenic
1065640654 10:27778654-27778676 CCAGCCAAGTCCAGCCTTAATGG - Intergenic
1065907583 10:30272032-30272054 CCAGCCAAGAGAAGCCGTGAAGG + Intergenic
1068287873 10:54962807-54962829 CCAGCCAAGAACAGCCTGCTGGG + Intronic
1070905387 10:80067835-80067857 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1073980574 10:109149035-109149057 CCCACAAAGAACAGCTTTGCAGG + Intergenic
1078087286 11:8241847-8241869 GGCCCCAAGAACAGCCTTCATGG - Intronic
1082160750 11:48885437-48885459 CCTGCCTAGAACCGCCTGGAGGG + Intergenic
1082161616 11:48894969-48894991 CCTGCCTAGAACCGCCTGGAGGG - Intergenic
1082167198 11:48963398-48963420 CCTGCCTAGAACTGCCTGGAGGG - Intergenic
1082236380 11:49823301-49823323 CCTGCCTAGAACTGCCTGGAGGG + Intergenic
1082239830 11:49857808-49857830 CCTGCCTAGAACTGCCTGGAGGG + Intergenic
1082609868 11:55283176-55283198 CCTGCCTAGAACTGCCTGGAGGG + Intergenic
1082656813 11:55867347-55867369 CCTGCCTAGAACTGCCTGGAGGG - Intergenic
1084705292 11:70812818-70812840 CTGGCCAAGAACAGCCAGGAGGG + Intronic
1091108598 11:132944393-132944415 CCAGCCAAGTCCAGCCCTGACGG + Intronic
1096544596 12:52328900-52328922 CCCTCCAACAACAGGCTTGTGGG - Intergenic
1098138530 12:67428194-67428216 CCTGCCAAGAACTGCCAAGAGGG - Intergenic
1098183303 12:67870378-67870400 CCCACCAAGAACAGCTTTGCAGG + Intergenic
1098183471 12:67872314-67872336 CCCACAAAGAACAGCTTTGCAGG + Intergenic
1100264697 12:92964367-92964389 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1108046962 13:46392274-46392296 CCCACAAAGAACAGCTTTGCAGG - Intronic
1114229418 14:20767087-20767109 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1114399798 14:22399591-22399613 CCCCCCAAGAACAGCCCTTCAGG + Intergenic
1115357102 14:32460501-32460523 CCAGCCAAGAGAAGCCTTGAGGG + Intronic
1118840347 14:69505197-69505219 CATGCCCAGAACAGCCTTCATGG - Intronic
1120043217 14:79777022-79777044 CCTGACAAGAACAACCTTGCAGG - Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1123128022 14:105963501-105963523 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1123193319 14:106592246-106592268 CCCGTCTAGAACAGTCTTTATGG - Intergenic
1123408544 15:20039667-20039689 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1123517875 15:21046377-21046399 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1125717001 15:41825075-41825097 CCCGCCAAGATCAGCATGTATGG - Intronic
1129446785 15:75624718-75624740 CCCGCCAAGAACAGCCTTGAAGG - Exonic
1132059651 15:98681648-98681670 TCCCCCAAGAATAGCCTTGAGGG - Intronic
1133154581 16:3864023-3864045 CCAGCCAAGAACAGTCCTGGAGG + Intronic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1139250369 16:65489711-65489733 TCCGTAAAGATCAGCCTTGATGG + Intergenic
1139641469 16:68294697-68294719 CCCACGAAGAACAACCTAGAAGG - Exonic
1141744491 16:85916379-85916401 ACCCACAAGAACAGCCTTGCTGG - Intronic
1145956184 17:28856445-28856467 CCCTCCAAGACCATCCTTGAAGG - Intronic
1146665725 17:34701837-34701859 CCACCCAAGAACAGACATGAGGG + Intergenic
1147653033 17:42072731-42072753 CCGGCCCAGGACAGCCTTGGCGG + Intergenic
1148206268 17:45782239-45782261 CCCACAAAGAACTGCCTAGAGGG + Intergenic
1150170159 17:62986348-62986370 CCTGCCAGGAGCAGCCTTCAGGG + Intergenic
1150956066 17:69862023-69862045 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1151410871 17:73927757-73927779 CCAGCTAAGAAAAGCCTAGATGG - Intergenic
1151907822 17:77060551-77060573 CCAGCCAATAACAGTCTTGGTGG - Intergenic
1152121519 17:78421808-78421830 CCTGCCTAGGACAGCCTCGAAGG - Intronic
1152716128 17:81901744-81901766 CCCGCCAGTAACAGCCCTGCTGG + Intronic
1152960369 18:76106-76128 CCCGCCATCCCCAGCCTTGACGG + Intergenic
1153157128 18:2162409-2162431 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1154105028 18:11515366-11515388 CCTGCCTAGCACAGCCCTGATGG + Intergenic
1157090593 18:44632193-44632215 CCCACTAAGGACAGCATTGAAGG - Intergenic
1159937992 18:74383842-74383864 CCCACAAAGAACAGCTTTGCAGG + Intergenic
1161069438 19:2252929-2252951 CCCGCCAAGCTCAGCCCCGAGGG - Exonic
1162958857 19:14114484-14114506 CCCCCCAAGAAGACCCTAGATGG - Intronic
1164539121 19:29109158-29109180 CCCGCCAAGGAGGGCCTTGTAGG + Intergenic
1168084500 19:54035460-54035482 CCCACCAAGGACAGCTTTGCAGG + Intergenic
1168108524 19:54179198-54179220 ACAGCCATGAAAAGCCTTGAAGG + Intronic
929549426 2:42880106-42880128 CCTGCCCGGACCAGCCTTGAGGG - Intergenic
932346018 2:70995448-70995470 CCCCAAAAGAACAGCCTAGAGGG - Intergenic
932939023 2:76139951-76139973 CCAGCCAAGAGAAGCCATGAGGG - Intergenic
933789199 2:85870360-85870382 CCTGCCAACAAAAGCCTTGGAGG - Intronic
935612123 2:105036753-105036775 CCCTCCAAGGACAGCTTTGCAGG + Intergenic
936871262 2:117136155-117136177 CCCACAAAGAACAGCTTTGCAGG + Intergenic
937526070 2:122771993-122772015 CCAGCCAAGAGAAGCCATGAGGG + Intergenic
942155381 2:173122232-173122254 CCCCCAAAGAACAGCTTTTAAGG - Intronic
947427036 2:229993174-229993196 CCCACAAAGAACAGCTTTGCAGG - Intronic
948066821 2:235087322-235087344 CCCGCCAGGAACAGCATGGTGGG - Intergenic
1169757803 20:9062047-9062069 CCGGCCAAGACCAGCTTTCAAGG + Intergenic
1170987743 20:21273955-21273977 CAGGCCAAGATCAGCCTTCAAGG - Intergenic
1173696279 20:45016761-45016783 AGAGCCAAGAACAGCCATGAGGG + Intronic
1176362274 21:6007745-6007767 CCCACAAAGAACAGCTTTGCAGG + Intergenic
1179761244 21:43530800-43530822 CCCACAAAGAACAGCTTTGCAGG - Intronic
1179876952 21:44273402-44273424 CCCCCCACCAAAAGCCTTGAGGG + Intergenic
1180725287 22:17942343-17942365 CCCACCAAGAACAGCTCTGTGGG + Intronic
1181160750 22:20958106-20958128 CCCGCCAAGGAAAGCCCTGGGGG + Intergenic
951332642 3:21384851-21384873 CCCACAAAGAATAGCCTTGGAGG + Intergenic
957297627 3:78353268-78353290 CCCACCAAGAACAGATTTGCAGG - Intergenic
957993316 3:87654099-87654121 CCAGCCAAGGGAAGCCTTGAGGG - Intergenic
961164099 3:124751584-124751606 CCCACAAAGAACAGCTTTGCAGG - Intergenic
964612757 3:158631529-158631551 CCCACAAAGAACAGCTTTGCAGG + Intergenic
968199210 3:196738118-196738140 CCCTCCAAGAACAGACTGGGGGG - Intergenic
970093199 4:12432533-12432555 CCCACAAAGAACAGCTTTGCAGG - Intergenic
972535553 4:39996910-39996932 CCCACAAAGAACAGCTTTGCAGG - Intergenic
972566256 4:40271968-40271990 CCCACAAAGAACAGCTTTGCAGG - Intergenic
972929567 4:44054969-44054991 GCTACCAAGAAGAGCCTTGAAGG + Intergenic
975442426 4:74426845-74426867 CCCTCCAAGAATAGCCATGATGG - Intergenic
976114790 4:81715161-81715183 CCAGCCAAGAGAAGCCCTGAAGG + Intronic
978337388 4:107684421-107684443 CCCACAAAGAACAGCTTTGCAGG - Intronic
979420991 4:120504937-120504959 CAGGCCAAGATCAACCTTGATGG - Intergenic
985482864 5:128225-128247 CCCACCAAGGACAGCTTTGCAGG + Intergenic
985974471 5:3405191-3405213 CCCCCCAAGACCAGCCCTTAAGG - Intergenic
986358478 5:6952034-6952056 CCAGCCAAGGGAAGCCTTGAGGG + Intergenic
987356568 5:17068492-17068514 CCCACAAAGAACAGCTTTGCAGG - Intronic
990307622 5:54508455-54508477 CCCACAAAGAACAGCTTTGCAGG + Intergenic
995741266 5:115358304-115358326 CCCACAAAGAACAGCTTTGCAGG - Intergenic
995873385 5:116765390-116765412 CTTGCCACAAACAGCCTTGAAGG - Intergenic
996380704 5:122860125-122860147 CCCACAAAGAACAGCTTTGCAGG + Intronic
997203472 5:132026916-132026938 TCAGCCAAGACCAGCCTTGTGGG - Intergenic
997986422 5:138504906-138504928 CCTGCCAAGTCCAGCCCTGATGG - Intergenic
999983861 5:156984352-156984374 CTAGCCAAGGAAAGCCTTGAGGG + Intergenic
1004604962 6:17185374-17185396 CCCACAAAGAACAGCTTTGCAGG + Intergenic
1005925047 6:30437089-30437111 CCAGCAAAGAAAAGCCCTGATGG + Intergenic
1008218760 6:48828160-48828182 CCCACAAAGAACAGCTTTGCTGG + Intergenic
1009718324 6:67428606-67428628 CTAGCCAAGAAAAGCCCTGAGGG - Intergenic
1012634066 6:101513506-101513528 CCCACAAAGAACAGCTTTGCAGG + Intronic
1013412727 6:109896214-109896236 CCCACAAAGGACAGCTTTGAAGG + Intergenic
1013956847 6:115852216-115852238 CCAGCCAAGGGAAGCCTTGAAGG + Intergenic
1014408536 6:121084100-121084122 CCAGGCAAGACCACCCTTGATGG - Intronic
1017863493 6:158421701-158421723 CCCACAAAGAACAGCTTTGTAGG + Intronic
1017895228 6:158673732-158673754 CCCGCCAGGAACAGCTTTGAAGG + Intronic
1018075472 6:160208530-160208552 CCCACAAAGAACAGCTTTGCAGG - Intronic
1018391323 6:163343837-163343859 CCGGCCAAGGGCAGCCTGGATGG + Intergenic
1018835824 6:167483109-167483131 CCCACAAAGAACAGCTTTGCAGG + Intergenic
1018992167 6:168682422-168682444 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1019062971 6:169270139-169270161 CCCACAAAGAACAGCTTTGCAGG - Intergenic
1019325065 7:433919-433941 CCCACCAAGAAAAGCCGTGCAGG + Intergenic
1022964553 7:35460404-35460426 CCTCACAAGAACAGCCTTGTGGG - Intergenic
1023610820 7:41968517-41968539 CCAGCCCTGAACAGCCTAGAGGG - Intronic
1026143112 7:67722961-67722983 CCCACAAAGGACAGCCTTGCAGG - Intergenic
1026679685 7:72456234-72456256 CCCACCAAGCCCAGCCATGAAGG - Intergenic
1033122387 7:138677533-138677555 CCCACAAAGAACAGCTTTGCAGG - Intronic
1034051435 7:147988375-147988397 CCCACAAAGAACAGCTTTGGAGG + Intronic
1034991225 7:155549181-155549203 GCCGGCAAGTCCAGCCTTGAGGG - Intergenic
1035601805 8:901697-901719 TCCAGCAAGAACAGCCTCGATGG + Intergenic
1036525223 8:9528764-9528786 CTCGCAAAGAACAGCTTTGCAGG - Intergenic
1037761412 8:21744226-21744248 CCCCCTGAGGACAGCCTTGAGGG + Intronic
1038216337 8:25564918-25564940 CCGGCCAAGAAGAGACTGGAAGG + Intergenic
1039814593 8:41081923-41081945 CCCCCAAAGAACAGCTTTGCAGG + Intergenic
1040290169 8:46120166-46120188 CCCGCCCAGGACAGTCCTGAGGG + Intergenic
1040290547 8:46121903-46121925 CCCGCCAGGACCAGCCCTGGGGG + Intergenic
1040299161 8:46179082-46179104 CCCACCTGGGACAGCCTTGAGGG + Intergenic
1040303137 8:46198409-46198431 CCCACCTGGGACAGCCTTGAGGG - Intergenic
1040305570 8:46210071-46210093 CCTGACCAGGACAGCCTTGAGGG - Intergenic
1040312000 8:46241595-46241617 CCCGCTATGTACAGCCTAGAGGG - Intergenic
1040316060 8:46261475-46261497 CCCGCCAGGGACAGCCCTGGGGG - Intergenic
1040329716 8:46379641-46379663 CCCGCCAGGGACAGCCATAAGGG - Intergenic
1040336486 8:46418657-46418679 CCCGCCCAGGACAGCCCTGAGGG - Intergenic
1040341979 8:46445696-46445718 CCTGCCCAGGACAGCCCTGAGGG + Intergenic
1042582610 8:70297627-70297649 CCAGCCAAGGACAGCCTTTATGG + Intronic
1044503493 8:92990668-92990690 CTAGCCAAGGAAAGCCTTGAGGG + Intronic
1045067984 8:98469233-98469255 CCCGCAAAGAAAAGCCTTTTTGG - Intronic
1048270874 8:133027039-133027061 TCCACCAGGTACAGCCTTGAGGG - Intronic
1048314774 8:133353905-133353927 GCCGCCCAGAACAGACTGGATGG + Intergenic
1048886161 8:138911581-138911603 CCAGCCATGGACAGCCTTGCAGG + Intronic
1050830795 9:10009721-10009743 CCCGCAAAGGACAGCTTTGCAGG + Intronic
1053489242 9:38487288-38487310 CCCGCCAGCAACAGCCTTATGGG + Intergenic
1056666863 9:88588154-88588176 CAGGCCAAACACAGCCTTGAGGG + Intergenic
1061263437 9:129492375-129492397 CCCTTCAACAACAGCCCTGAGGG - Intergenic
1061553350 9:131350480-131350502 CACCCCAAGAGCAGCCTTGGAGG + Intergenic
1186281205 X:7995063-7995085 CCGGCCTAGACCATCCTTGAAGG - Intergenic
1189675970 X:43460963-43460985 CCCTCCAAGAAGAACCTTTATGG - Intergenic
1189784565 X:44547878-44547900 CCCACAAAGAACAGCTTTGTAGG + Intergenic
1191875304 X:65788886-65788908 CCCCACAAGAACAGACTTGGTGG + Intergenic
1191909013 X:66127440-66127462 CCAGCCAAGAGAAGCCATGAGGG - Intergenic
1192740959 X:73892446-73892468 CTAGCCAAGAAAAGCCTTCAGGG + Intergenic
1193525348 X:82581558-82581580 CTAGCCAAGAAAAGCCATGAAGG - Intergenic
1196281246 X:113825741-113825763 CTAGCCAAGAAAAGCCATGAGGG - Intergenic
1200740332 Y:6847026-6847048 CTAGCCAAGAGAAGCCTTGAGGG - Intergenic
1201608658 Y:15816048-15816070 CCAGCCAAGAGAAGCCTTGAGGG + Intergenic
1202068053 Y:20961110-20961132 CCCACAAAGAACAGCATTGTAGG + Intergenic