ID: 1129446838

View in Genome Browser
Species Human (GRCh38)
Location 15:75625074-75625096
Sequence GGGTTGAAACAGCAGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129446838_1129446841 -10 Left 1129446838 15:75625074-75625096 CCGGGCTCCTGCTGTTTCAACCC 0: 1
1: 0
2: 0
3: 27
4: 273
Right 1129446841 15:75625087-75625109 GTTTCAACCCATTCCTTGGATGG 0: 1
1: 0
2: 0
3: 3
4: 94
1129446838_1129446849 27 Left 1129446838 15:75625074-75625096 CCGGGCTCCTGCTGTTTCAACCC 0: 1
1: 0
2: 0
3: 27
4: 273
Right 1129446849 15:75625124-75625146 GTTCGGACCTTAGCCCCAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 60
1129446838_1129446848 24 Left 1129446838 15:75625074-75625096 CCGGGCTCCTGCTGTTTCAACCC 0: 1
1: 0
2: 0
3: 27
4: 273
Right 1129446848 15:75625121-75625143 AGTGTTCGGACCTTAGCCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1129446838_1129446845 10 Left 1129446838 15:75625074-75625096 CCGGGCTCCTGCTGTTTCAACCC 0: 1
1: 0
2: 0
3: 27
4: 273
Right 1129446845 15:75625107-75625129 TGGTGCTGCCTCCAAGTGTTCGG 0: 1
1: 0
2: 1
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129446838 Original CRISPR GGGTTGAAACAGCAGGAGCC CGG (reversed) Intronic
900154729 1:1199329-1199351 GGGGTGAAGCAGGAGGGGCCTGG + Intergenic
900469271 1:2844937-2844959 GGTTTGAAACACCAGGATCTTGG + Intergenic
901419079 1:9138017-9138039 TGGTTGAAAAACCAGGAGACAGG - Intergenic
901534882 1:9875592-9875614 GAGTTGAAGCAGGAGTAGCCTGG - Intronic
902359946 1:15936950-15936972 GGGTAGCATCAGCAGGAGGCAGG + Intronic
902644815 1:17790857-17790879 GGGCTGAGGCAGCAGGAGGCTGG + Intronic
902977311 1:20098294-20098316 GGGAAGAAACAGCAAGAGCAAGG - Intergenic
903134913 1:21302994-21303016 GGGCAGAAATAGCAGGAGCCTGG - Intronic
903545709 1:24122116-24122138 GGGTGGGAAAAGAAGGAGCCAGG + Intronic
906193265 1:43912792-43912814 AGGTTGCATCAGCAGGAGTCTGG + Intronic
906809523 1:48811843-48811865 GGGTTGACACAGCAGTGTCCAGG + Intronic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
912091056 1:106076906-106076928 GGATTGAGACAGAATGAGCCAGG + Intergenic
912093704 1:106113981-106114003 GGGCTGAGACAGCAGGGGTCTGG - Intergenic
913996444 1:143654664-143654686 GAGTGGGACCAGCAGGAGCCTGG - Intergenic
914376372 1:147077253-147077275 GAGTGGGACCAGCAGGAGCCGGG + Intergenic
915081067 1:153353168-153353190 GGGTTGGAGCAACAGAAGCCAGG + Intergenic
915346933 1:155202355-155202377 GTGTTGATGCAGCTGGAGCCCGG + Exonic
915569522 1:156736860-156736882 GGGATGAAACTGAAGGAACCAGG - Exonic
917848878 1:179043198-179043220 GGGCTGAGACAGCAGGGGCCTGG + Intronic
923010265 1:230082984-230083006 GGGATGAAACAGCAGGGAGCTGG + Intronic
924444009 1:244111653-244111675 GGGTTGATAGGGCAGGAGCGTGG - Intergenic
924645324 1:245872345-245872367 TGGGTGAAGCAGCAGGAGGCGGG - Intronic
1062816710 10:506351-506373 GGGTTGGGACAGCAGCAGCAAGG + Intronic
1064172966 10:13050319-13050341 GGAATTAAACAGCAGGAGGCAGG + Intronic
1065366090 10:24938410-24938432 GGGTGGAAACAGCATGAGTCTGG + Intronic
1065777695 10:29136874-29136896 GGGCTGAAACAGCTGAAGGCTGG + Intergenic
1066756153 10:38714914-38714936 GATTTGAAACAGCGGGACCCTGG + Intergenic
1067554895 10:47261881-47261903 AGGTAGACAGAGCAGGAGCCAGG - Intergenic
1068024847 10:51629874-51629896 GGTTTGAAAGAGATGGAGCCAGG - Intronic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1070762661 10:79034415-79034437 GGATTGAAAGAGCAGGAACAGGG - Intergenic
1073513510 10:104057372-104057394 AGGTTCACACAGCTGGAGCCAGG - Intronic
1075120570 10:119661497-119661519 GGAATGAACCAGCATGAGCCCGG - Intronic
1075662092 10:124204802-124204824 AGGTTCTAGCAGCAGGAGCCTGG + Intergenic
1076287631 10:129315610-129315632 GGAGTGAATGAGCAGGAGCCAGG + Intergenic
1076734210 10:132451529-132451551 GGTTTGGAACAGCCAGAGCCTGG - Intergenic
1077494330 11:2879135-2879157 GGGATGAAACGGCAGGACCCTGG + Intergenic
1078654044 11:13221712-13221734 GGGTTCAAAAGGCAGGAGCAGGG + Intergenic
1080771367 11:35345279-35345301 GGTTTGCAAAAGCAGGAGCAAGG - Intronic
1081022952 11:37970011-37970033 GGGTTGAACAAGCAGGATCATGG - Intergenic
1081915424 11:46727475-46727497 GGGTGCAAAAAGCAGGAGGCAGG + Intronic
1083691329 11:64410574-64410596 GGGATGAGACAGCAGGAGGCAGG - Intergenic
1084182658 11:67454508-67454530 GGGTGGAAGGAGCAGGAGCAGGG + Intronic
1084333177 11:68441563-68441585 GGGTTGCAGCAGCAGGAGCAGGG - Intronic
1084967471 11:72752106-72752128 GGGGTGAACCAGCGGGACCCGGG - Intronic
1085804404 11:79621530-79621552 GAGTCGAAAGAGCAAGAGCCAGG - Intergenic
1085928583 11:81053673-81053695 GGATTCAAACAGCAGCAGCATGG - Intergenic
1086760754 11:90627501-90627523 GGGTTGAAACCGTAGAAGTCAGG + Intergenic
1086778436 11:90870320-90870342 TGGTTGAAAAAGCAGCAGCAGGG + Intergenic
1088182961 11:107132934-107132956 GGGTAGAGACAACAGGAGACTGG + Intergenic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1089293980 11:117457233-117457255 GGTTATACACAGCAGGAGCCCGG - Intronic
1089376547 11:117999077-117999099 GGGGAGCAACAGCAGGGGCCAGG + Exonic
1089499289 11:118923124-118923146 GGGTTGCAGCAGCAGCTGCCGGG - Intronic
1089928195 11:122281242-122281264 GGAAAGAAATAGCAGGAGCCGGG + Intergenic
1090049791 11:123367952-123367974 GGGGAGAAAGAGGAGGAGCCAGG + Intergenic
1090450206 11:126799672-126799694 GGGGTGGAGCAGGAGGAGCCGGG + Intronic
1091116176 11:133015821-133015843 AGGAGGAAACAGCAGGAGCAAGG - Intronic
1091544322 12:1491031-1491053 AGGTTGAAAGAGCACCAGCCAGG + Exonic
1091587268 12:1823370-1823392 AGGTTGGGACGGCAGGAGCCTGG - Intronic
1092238051 12:6821989-6822011 GGGCAGAAACAGCAGGTGGCTGG - Intronic
1092481239 12:8860965-8860987 GGGTATCAAGAGCAGGAGCCAGG - Intronic
1092776269 12:11947364-11947386 GGGAGGAAACAGAAGGAACCAGG + Intergenic
1096736494 12:53659453-53659475 GGCTGGAAACATCAGGAGCTTGG + Intronic
1096815619 12:54200095-54200117 GGGAGGAAACAGGAGGAGCCAGG + Intergenic
1096995013 12:55832955-55832977 GTCTTGAAGCAGCAGTAGCCTGG - Intergenic
1097194132 12:57234572-57234594 GGGTTCAAACAGAAAGTGCCTGG - Exonic
1097867804 12:64573863-64573885 GGGTGTCAACAGCAGGAGTCAGG + Intergenic
1101357506 12:103994419-103994441 GGATTGAAAGAGCAGGTGCTGGG + Exonic
1104951507 12:132442696-132442718 GGGTTTCACCTGCAGGAGCCGGG - Intergenic
1106230485 13:27817418-27817440 GGGATGGAGCAGCAGGAGGCTGG + Intergenic
1106655994 13:31746730-31746752 GGGTTGAAACAGAATGTCCCAGG - Intronic
1107140059 13:36988786-36988808 GGAGTGAAACGGCAGAAGCCTGG + Intronic
1107170916 13:37341411-37341433 GGATTGAGGCAGCAGGGGCCTGG - Intergenic
1109988065 13:70016573-70016595 GGGCTGAAACAGAAGGAGGCTGG - Intronic
1111247673 13:85562265-85562287 TGTTGGAAACAGCAGGAGCCAGG + Intergenic
1111549161 13:89784424-89784446 GGGCTGAGGCAGCAGGGGCCTGG + Intergenic
1111947152 13:94677940-94677962 GGCTTGAAGCAGCAGGGGTCTGG + Intergenic
1112193273 13:97199129-97199151 GGCCAGAAACAGCAGGAGGCTGG - Intergenic
1112364750 13:98747156-98747178 GGGTTGCAACACCAAGAACCAGG - Intronic
1113201827 13:107875014-107875036 GGGCTGAAACAGAAGGAAACTGG + Intergenic
1113557647 13:111251330-111251352 GGAGTGGAACAGTAGGAGCCCGG + Intronic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1113987330 13:114328703-114328725 GGTCTGAGACTGCAGGAGCCAGG - Intergenic
1114531368 14:23398653-23398675 GCTTTGAAGCAGCAGGACCCTGG + Intronic
1115731303 14:36272387-36272409 GGGTTCAAACAGCAGCTGTCTGG - Intergenic
1118725173 14:68623943-68623965 GGTTGGAAACACCAGGAGTCTGG + Intronic
1119225501 14:72941967-72941989 GGGTTTAAGCAGCAGAAGGCAGG - Intronic
1119587363 14:75848972-75848994 GTGTGGAAACAGCAGAAGTCTGG + Intronic
1119694903 14:76705423-76705445 GTGCTGAGACAGCAGGAGCAGGG - Intergenic
1120026929 14:79596894-79596916 GGATTGACACAGCGGGAGCATGG - Intronic
1120915280 14:89704899-89704921 GGGTGGAAATAGGAGTAGCCTGG - Intergenic
1123440411 15:20286978-20287000 GATTTGAAACAGCGGGACCCTGG + Intergenic
1128385565 15:67145812-67145834 CGGTGGAAACAACAGGAGACTGG - Intronic
1128893913 15:71355757-71355779 CGTTTGAATCAGCAGGACCCAGG + Intronic
1129253356 15:74320525-74320547 GGGTACAAACAGCAGCTGCCAGG + Intronic
1129446838 15:75625074-75625096 GGGTTGAAACAGCAGGAGCCCGG - Intronic
1129774813 15:78229791-78229813 GGGTGCAAGCAGCAGAAGCCTGG - Intronic
1130384926 15:83402775-83402797 GGATAGAAACAGCAGCAGCAAGG - Intergenic
1135950488 16:26909759-26909781 GAGTGGAAACCGCAGGAGCTTGG - Intergenic
1139068307 16:63346842-63346864 GGTTTAAAACAACATGAGCCAGG - Intergenic
1140778983 16:78276475-78276497 GGGCTCAAACATCAGGAGACTGG - Intronic
1141166035 16:81661677-81661699 GGGGTGGAACAGCAGGCCCCTGG + Intronic
1141584610 16:85025362-85025384 GGGTTGGCTCAGCAGGATCCAGG - Intergenic
1141985227 16:87575489-87575511 GGGTTGAGAGAGCGGGATCCGGG + Intergenic
1142129273 16:88425363-88425385 GGGTAGGAACAGCAACAGCCAGG - Intergenic
1142698925 17:1648156-1648178 GGGTTGCAGCTGCAGCAGCCAGG - Intronic
1142744691 17:1950002-1950024 GGGTCAGAACAGCAGGAGCCAGG + Intronic
1143096598 17:4481548-4481570 GGGTGGAAACTGCAGGTGTCTGG + Intronic
1143636651 17:8167854-8167876 AGCTAGAAACAGCAGGATCCAGG + Intergenic
1143882032 17:10037002-10037024 GGGTTCACACAGCTGGGGCCGGG - Intronic
1144202398 17:12953289-12953311 AGTGTGAAGCAGCAGGAGCCAGG - Intronic
1144529475 17:16022208-16022230 GAGTTGACACAGCAGAAGCCCGG - Intronic
1144713830 17:17420787-17420809 ATGTTGAAAGAGCAGGGGCCTGG - Intergenic
1144961611 17:19047364-19047386 GGATTGAAGGAGCAGGAGGCAGG - Exonic
1144973549 17:19127160-19127182 GGATTGAAGGAGCAGGAGGCAGG + Intergenic
1147605161 17:41770270-41770292 GGGTTCAGAGAGCAGGAGCTGGG + Intronic
1147884588 17:43676117-43676139 GGGTTGAGCCTGCAGAAGCCCGG + Intergenic
1147957952 17:44147976-44147998 GGGGTGTAACAGCAGCAGCCTGG - Exonic
1147977206 17:44254713-44254735 GGGTGGGAGCAGGAGGAGCCAGG + Intronic
1148002862 17:44400134-44400156 GGCCTGAACAAGCAGGAGCCTGG - Exonic
1148664017 17:49361672-49361694 GGGGCGAAAGAGCAGGAGCGGGG + Intronic
1149377209 17:56056969-56056991 GGGTTGATAAAGCAGTAGCAGGG - Intergenic
1150247631 17:63688362-63688384 GGGTGGAGAAAGCAGGAGCTGGG + Intronic
1151348202 17:73516201-73516223 TGGTAGAGACAGCTGGAGCCTGG + Intronic
1151757588 17:76083471-76083493 GTGGGGAAAAAGCAGGAGCCAGG + Exonic
1151958926 17:77394833-77394855 GGGTCGAAACAGGAGCAGCCTGG - Intronic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152239543 17:79154269-79154291 GCTTTGAAACAGAAGGAGCTGGG - Intronic
1152677231 17:81647944-81647966 GGGTCGATGCAGCAGGAGGCGGG - Exonic
1153578302 18:6545156-6545178 GGTTTGAAAGAGCTGGAGGCAGG + Intronic
1156039623 18:32805864-32805886 GGATTGAAACACCAGGAGACTGG + Intergenic
1157006482 18:43589885-43589907 GGGCCGAAGCAGCAGGAGGCTGG + Intergenic
1157304839 18:46509368-46509390 GGGTTGAGAGAGGAGGAGCAAGG - Intronic
1157469742 18:47979903-47979925 GGGTTGGAACTGCAGGAACCTGG - Intergenic
1158084927 18:53639869-53639891 AGATAGAAGCAGCAGGAGCCTGG - Intergenic
1158574231 18:58622791-58622813 GGGTGGGAACATAAGGAGCCTGG - Intronic
1158646342 18:59251205-59251227 GTGTGTAAACAGCAAGAGCCTGG + Intergenic
1159363815 18:67439801-67439823 GGGTTCAAATAGCAGTAGCCAGG - Intergenic
1159623801 18:70669370-70669392 GGGCTGAGACAGCAGGGGGCTGG - Intergenic
1162079630 19:8210176-8210198 GGCTTGGAACAGCAGGTGCATGG + Intronic
1162145019 19:8608260-8608282 GGGGTCAAAGAGGAGGAGCCGGG + Exonic
1162439146 19:10682034-10682056 CGGTTGAACCAGCTGAAGCCAGG + Exonic
1162529762 19:11229132-11229154 GGGTTAGTGCAGCAGGAGCCAGG + Intronic
1166815290 19:45541147-45541169 GGATTGAACGAGAAGGAGCCTGG - Intronic
1168490362 19:56803806-56803828 GGGTTAAAAGAGCAGGACCCAGG - Intronic
925333141 2:3074325-3074347 GTGTTCAAATAACAGGAGCCGGG + Intergenic
926725585 2:15994972-15994994 ATGTTGAAACAGCAAGGGCCAGG - Intergenic
930030572 2:47055989-47056011 GGGAAGAAAAAGCTGGAGCCAGG - Intronic
931366010 2:61619665-61619687 GGGATGAAACAGCAGGTCCCAGG + Intergenic
932398330 2:71463198-71463220 GGGTTGAGGCAGCAGGGGGCTGG + Intronic
932569247 2:72929348-72929370 GGGCTGAAAGAGGAGGAGACAGG + Intronic
933685970 2:85141457-85141479 TGCTTGAAACTGCAGGAGTCTGG - Intronic
933801217 2:85961607-85961629 GGGCTGAAGCAGCAGGGGACTGG + Intergenic
934738677 2:96703471-96703493 GAGTGCAGACAGCAGGAGCCGGG - Intergenic
935225849 2:101052322-101052344 GGTTTCTAACAGCAGTAGCCAGG + Intronic
935377670 2:102416692-102416714 GGGTTAGAACAGCTGGGGCCTGG + Intergenic
935549481 2:104437276-104437298 CGCTTGTACCAGCAGGAGCCTGG + Intergenic
937963301 2:127480490-127480512 GGGTTGGGCCAGCAGGACCCGGG - Intronic
938183722 2:129208480-129208502 GGGTTGAAACACCAAGAGAACGG + Intergenic
938278862 2:130050937-130050959 GGACTGAATCAGAAGGAGCCAGG + Intergenic
938360110 2:130679705-130679727 GGACTGAACCAGAAGGAGCCAGG - Intergenic
938380236 2:130832322-130832344 GGGGTGAAGCAGGAGGGGCCAGG - Intergenic
938436512 2:131286412-131286434 GGACTGAATCAGAAGGAGCCAGG - Intronic
938926905 2:136051683-136051705 GCCTTGAGACAGCAAGAGCCTGG + Intergenic
939722594 2:145673648-145673670 GGGTTGATAAAGCAGGGGCAGGG - Intergenic
943536090 2:189152588-189152610 GGGGTGGAGCAACAGGAGCCAGG - Intronic
945243021 2:207693737-207693759 AGGTGGAAACAGTAAGAGCCTGG + Intergenic
946046998 2:216829629-216829651 CTCTTGATACAGCAGGAGCCTGG + Intergenic
947150473 2:227110182-227110204 GGGCAGAGTCAGCAGGAGCCCGG - Intronic
1168821281 20:775185-775207 AGGCTGAAGCCGCAGGAGCCTGG - Intergenic
1168870274 20:1121606-1121628 GGGTGGAAACAGCAGATGGCTGG - Intronic
1168983468 20:2027118-2027140 GGGCTGAGGCAGCAGGAGGCTGG + Intergenic
1170311567 20:14997742-14997764 GCCTTGAATCAGCAGTAGCCAGG + Intronic
1171237233 20:23536825-23536847 GGCCTGAAGCAGCAGCAGCCTGG - Intergenic
1171250208 20:23640640-23640662 GGGCTGGATCAGCAGGAACCCGG + Intergenic
1171256316 20:23691260-23691282 GGGATGGATCAGCAGGAACCTGG + Intergenic
1171263669 20:23753170-23753192 GGGCTGGATCAGCAGGAACCCGG + Intergenic
1171284251 20:23924366-23924388 GGGCTGGATCAGCAGGAACCCGG + Intergenic
1171417814 20:24995321-24995343 GAGTTGAAACAGCATGGGACTGG - Intergenic
1171418507 20:25000260-25000282 GAGTTGAAACAGCATGGGACTGG + Intergenic
1172503036 20:35440492-35440514 GGGTTGAACCAGAGAGAGCCTGG - Intronic
1174802854 20:53579672-53579694 TGCTTGAAAGAGCAGGAACCAGG - Intronic
1175698146 20:61117840-61117862 GGGTGGAACCTGCAGGGGCCTGG - Intergenic
1178521113 21:33289194-33289216 GAGGTGAGACAGCAGCAGCCAGG + Intronic
1179998543 21:44984935-44984957 GGGTTCAGGCAGCGGGAGCCAGG - Intergenic
1180307647 22:11142797-11142819 GATTTGAAACAGCGGGACCCTGG + Intergenic
1180307786 22:11144026-11144048 GATTTGAAACAGCGGGACCCTGG + Intergenic
1180546167 22:16505020-16505042 GATTTGAAACAGCGGGACCCTGG + Intergenic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1184580606 22:45414013-45414035 GGGGTGAAAGGGCAGGGGCCGGG + Exonic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1185297450 22:50061334-50061356 GTGTCGTAACAGCAGGAGCATGG - Exonic
949842777 3:8338142-8338164 GAGGTTTAACAGCAGGAGCCTGG + Intergenic
949926643 3:9047283-9047305 GGCTTGAGACAGCAGGCACCTGG - Intronic
950476396 3:13217849-13217871 GGGGTGAAACAGCAAGAGTCTGG - Intergenic
953444113 3:42947936-42947958 GGGTTGGTAAAACAGGAGCCAGG + Intronic
953696814 3:45166306-45166328 GAGTTGAAGCCTCAGGAGCCTGG + Intergenic
953701432 3:45198941-45198963 GGGTTGAAGCAGCAGGTGGCCGG + Intergenic
954812683 3:53257683-53257705 GGGCTGGGCCAGCAGGAGCCAGG - Intergenic
955177309 3:56629798-56629820 AGGTTGAAAGAGCAGCAGACTGG - Intronic
956425332 3:69128585-69128607 TGTTTGAAACAGCATGAGACAGG - Intergenic
956966170 3:74463445-74463467 GGATTCTAACAGCAGGAGGCAGG - Intronic
959378041 3:105608840-105608862 GTGTTGAAAGAGCAGGGGCCTGG + Intergenic
960955070 3:123026285-123026307 GGGTGAGAGCAGCAGGAGCCGGG - Intronic
961216194 3:125162481-125162503 GGGTGGAAGCAACAGGAGCGTGG + Intronic
962728462 3:138257485-138257507 GGGTAGAACCAGCAAGAGTCAGG - Intronic
964282118 3:155079146-155079168 GGGTGGAGAAAGCAGGAGCAAGG + Intronic
965813472 3:172614548-172614570 GGGCTGAGACAGCAGGAAGCTGG + Intergenic
966239475 3:177740414-177740436 GGCTTGAAAGAGGAGGAGACTGG + Intergenic
968330219 3:197862291-197862313 GGTTTGAAACAGCAACAGGCCGG - Intronic
969350557 4:6595899-6595921 TGGTGTCAACAGCAGGAGCCGGG - Intronic
969535788 4:7755428-7755450 GGGCAGAGAGAGCAGGAGCCGGG - Intergenic
969677327 4:8621314-8621336 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969678282 4:8626952-8626974 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
969679238 4:8632590-8632612 GTGTGGAAACAGCAGGCGCAAGG + Intergenic
972443592 4:39120876-39120898 GCGCTGATACAGCAGGGGCCAGG + Intronic
972615477 4:40694156-40694178 GGGTTGGAGCAGCAGGAGGTGGG + Intergenic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
974624064 4:64399641-64399663 GGGTTGAAGCTCCAGCAGCCAGG - Intronic
975690501 4:76958152-76958174 GGGTTGACACAGCAACAGCCAGG - Intronic
978347709 4:107788806-107788828 GGGTTGAGTCAGCAGGGGGCTGG + Intergenic
984495643 4:180494002-180494024 AGGTTGAGGCAGGAGGAGCCTGG + Intergenic
984576642 4:181456505-181456527 AGGTTGATAAAGCAGGAGGCAGG + Intergenic
984881330 4:184412381-184412403 GGGTTGAGACAGCATGGGCTCGG - Intronic
985622430 5:962617-962639 TGGTGGACACAGCAAGAGCCTGG + Intergenic
986073690 5:4312800-4312822 GGGTTGAAGAAGAAGGAGACTGG - Intergenic
987294405 5:16537296-16537318 GGGTTGAAACCGCAGGCGTGAGG + Intronic
987393715 5:17401278-17401300 GGCTTGAAACTGCAAGATCCCGG - Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
990855946 5:60266511-60266533 AGGGTGAAGCAGCAGCAGCCTGG - Intronic
995764028 5:115596408-115596430 AGGTTGAAGCTGAAGGAGCCAGG - Intronic
996082809 5:119273928-119273950 GGGTTGAAGGAGTAAGAGCCAGG - Intronic
996611863 5:125391978-125392000 GAGTTGGTACAGCAGGCGCCAGG - Intergenic
997718003 5:136056466-136056488 GGGTGGAGAGAGCTGGAGCCTGG + Intronic
998416524 5:141950211-141950233 GGATGGAGACAGCAGGAGACTGG - Intronic
999171927 5:149602691-149602713 GGGATGAGACAGAAGGAGACAGG - Intronic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1001722001 5:173864563-173864585 GGGCTCAAACAGCAGGGGCGGGG + Intergenic
1002066657 5:176655222-176655244 AGATGGAAACAGCAGGACCCTGG + Intronic
1003315051 6:5004237-5004259 GCGTTGAAAAGGCAAGAGCCAGG - Intergenic
1005430031 6:25746760-25746782 AGGTTGGAATAGCAGGAGGCAGG - Intergenic
1006437310 6:34032783-34032805 GGGTTGCAACATCTGGAGACTGG + Intronic
1008960570 6:57261699-57261721 GGGTGGCAGCAGCAGGAGACTGG + Intergenic
1012491215 6:99784239-99784261 GGGAAAAAAGAGCAGGAGCCAGG + Intergenic
1013228081 6:108135195-108135217 GGGAACAAACAGCAGGTGCCCGG + Intronic
1018699757 6:166416982-166417004 GGGCTGAAAGAGAAGGAGTCAGG - Intronic
1018787450 6:167119138-167119160 GGGGACAAACAGCATGAGCCTGG - Intergenic
1019326705 7:442024-442046 GGGTTGGAACAAGAGGAGGCTGG - Intergenic
1025943670 7:66090687-66090709 GGGTAAAGACAGCTGGAGCCAGG - Intronic
1028527471 7:91801577-91801599 GGGGTGAAGCAGCAGGGGGCTGG + Intronic
1028737807 7:94237166-94237188 GAGTTGACACAGCAGGAGAAGGG + Intergenic
1029174571 7:98655595-98655617 AGGTTGTAACAGCAGCATCCTGG + Intergenic
1029653719 7:101911102-101911124 GAGCTGAGACAGCAGCAGCCAGG + Intronic
1030299867 7:107964147-107964169 TGGCTGAAACAGCTGGAGGCTGG - Intronic
1031859035 7:126957647-126957669 GGGCTGAGGCAGCAGGGGCCTGG - Intronic
1033227789 7:139574819-139574841 GGGTTGAAACAGCAGTATGTGGG + Intronic
1033649284 7:143328683-143328705 GATTTGACACAGCAGGAACCAGG - Intronic
1035081195 7:156217672-156217694 AGGGTGGGACAGCAGGAGCCCGG - Intergenic
1035675581 8:1453268-1453290 GGGGAGAAGCAGGAGGAGCCTGG + Intergenic
1036447982 8:8840094-8840116 GGGTTGGAACAGTAGGTGCTTGG - Intronic
1037389572 8:18379786-18379808 GGTTGGGAGCAGCAGGAGCCAGG - Intergenic
1038648069 8:29377806-29377828 TGCTTGAAAAAGCAGCAGCCTGG + Intergenic
1040105359 8:43538438-43538460 GGACTGAACCAGAAGGAGCCAGG - Intergenic
1040287128 8:46106137-46106159 GGGTTGAAGCAGCAAGACACAGG - Intergenic
1041687833 8:60660644-60660666 GGGGTGGAACTGCAGGTGCCTGG - Intergenic
1041996930 8:64073797-64073819 GGGTAGAAACAGCCCAAGCCTGG - Intergenic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1042872911 8:73414247-73414269 GATTTGAAAAAGCAGGAGTCTGG + Intergenic
1046237918 8:111451047-111451069 GAGGAGAAACAGCAGGACCCTGG + Intergenic
1047303903 8:123637834-123637856 GGTTAGAACCAGCAGAAGCCAGG + Intergenic
1048548021 8:135404986-135405008 GGGCTGAGACAGCAGGGGGCAGG + Intergenic
1048589323 8:135806411-135806433 GGGTTGACTCAACATGAGCCTGG + Intergenic
1049616652 8:143578470-143578492 GGGCTGAAACAGCTGGACCCGGG + Exonic
1049746134 8:144264114-144264136 GCGTGGGAACAGCAGGAGCCAGG - Exonic
1049781470 8:144430939-144430961 TGGTGGAAACCGAAGGAGCCAGG + Intronic
1052736676 9:32349633-32349655 AGGTTGAGACAGTGGGAGCCTGG + Intergenic
1052880825 9:33600085-33600107 GGACTGAACCAGAAGGAGCCAGG - Intergenic
1053495140 9:38544125-38544147 GGACTGAACCAGAAGGAGCCAGG + Intronic
1053667052 9:40323894-40323916 GGACTGAACCAGAAGGAGCCAGG - Intronic
1053916643 9:42949003-42949025 GGACTGAACCAGAAGGAGCCAGG - Intergenic
1054378199 9:64463922-64463944 GGACTGAACCAGAAGGAGCCAGG - Intergenic
1054517558 9:66052389-66052411 GGACTGAACCAGAAGGAGCCAGG + Intergenic
1056047991 9:82739127-82739149 GGGGTTAAGCACCAGGAGCCAGG - Intergenic
1057222061 9:93262785-93262807 GGGAAGCAGCAGCAGGAGCCAGG - Intronic
1057675045 9:97131489-97131511 GGACTGAACCAGAAGGAGCCAGG + Intergenic
1058592152 9:106576522-106576544 GGGTTGTGACAACAGGACCCAGG - Intergenic
1060531877 9:124352287-124352309 GTGTGGAAACAGCAGCCGCCCGG - Exonic
1061363448 9:130158000-130158022 GGGTCGACACAGCAGGAACAAGG - Intergenic
1061649855 9:132038782-132038804 GCTTTGAATCAGCAGGAGACAGG + Intronic
1062721318 9:138045757-138045779 GGGTTGAGGCAGCAGCAGGCTGG + Intronic
1186223718 X:7375581-7375603 GGGCTGAGGCAGCAGGAGGCTGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1193188904 X:78545807-78545829 GGGTTGAAAAAGGAGGAAGCTGG - Intergenic
1193467722 X:81868526-81868548 GGGCTGAGGCAGCAGGAGGCTGG + Intergenic
1193976985 X:88132892-88132914 GGGTGGAAATATCAGGAGCCTGG - Intergenic
1196086558 X:111689750-111689772 GGGTAGAAAGAGCAGGGGACTGG - Intronic
1199761478 X:150907587-150907609 TGGCTTAAACAGCAGGTGCCTGG - Intergenic
1199762126 X:150912981-150913003 AGATGGAGACAGCAGGAGCCAGG - Intergenic
1200001742 X:153065649-153065671 GGGCAGAAAGAGCAGGAGCAGGG + Intergenic