ID: 1129449113

View in Genome Browser
Species Human (GRCh38)
Location 15:75640076-75640098
Sequence CAGCTCGTGCAGGTTGTGGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129449105_1129449113 14 Left 1129449105 15:75640039-75640061 CCTCCCGCCGCTGCAGCCGGTAA 0: 1
1: 0
2: 1
3: 2
4: 72
Right 1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG 0: 1
1: 0
2: 0
3: 14
4: 136
1129449109_1129449113 -2 Left 1129449109 15:75640055-75640077 CCGGTAACGCCGCAGCACGCGCA 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG 0: 1
1: 0
2: 0
3: 14
4: 136
1129449106_1129449113 11 Left 1129449106 15:75640042-75640064 CCCGCCGCTGCAGCCGGTAACGC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG 0: 1
1: 0
2: 0
3: 14
4: 136
1129449108_1129449113 7 Left 1129449108 15:75640046-75640068 CCGCTGCAGCCGGTAACGCCGCA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG 0: 1
1: 0
2: 0
3: 14
4: 136
1129449107_1129449113 10 Left 1129449107 15:75640043-75640065 CCGCCGCTGCAGCCGGTAACGCC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129449113 Original CRISPR CAGCTCGTGCAGGTTGTGGT CGG Exonic
900177646 1:1297928-1297950 CAGCTCCTGCAGGCAGTGGAGGG + Exonic
900408233 1:2501737-2501759 GAGCAGGTGCAGGCTGTGGTGGG + Intronic
901508426 1:9701218-9701240 CAGCTGGAGCAGGGGGTGGTGGG - Intronic
901546134 1:9958983-9959005 TTGCTTGTGCAAGTTGTGGTAGG - Intronic
901830501 1:11889097-11889119 CGGCTGGTGCAGGTGATGGTGGG + Intergenic
903166454 1:21523794-21523816 CAGCTCGTGGAGCTAGTGGGTGG + Intronic
906048459 1:42851332-42851354 CCGCTCGTGCCGGATGCGGTTGG - Exonic
907868590 1:58422712-58422734 CAGCTGGTGTGGGTTGTGATAGG - Intronic
912463104 1:109850456-109850478 CAGCCCATGCAGTTTGTTGTAGG + Intergenic
914446158 1:147752385-147752407 AAGCTTGTGCAGGGTGTAGTTGG - Intergenic
922024419 1:221737528-221737550 CTGGTCGTGGTGGTTGTGGTGGG - Intronic
1067368761 10:45662017-45662039 CAGCATGGGCAGGTTCTGGTGGG - Intronic
1067472760 10:46548395-46548417 CAGCTGGTGCAGTTTGTGGAAGG - Intergenic
1067941375 10:50659789-50659811 CTGCTTGTGCAGGTTGTCATGGG - Intergenic
1070229301 10:74547730-74547752 CAGGAGGTGGAGGTTGTGGTGGG - Intronic
1070862613 10:79684751-79684773 CTGCTTGTGCAGGTTGTCATGGG - Intergenic
1076462326 10:130655823-130655845 CAGGGCGTGGACGTTGTGGTGGG - Intergenic
1076514328 10:131034681-131034703 CAGCTGGTGCTGGCTCTGGTGGG - Intergenic
1077036045 11:494972-494994 CAGCTCACGCAGGCTGTGGTTGG + Exonic
1078358668 11:10651902-10651924 CAGCTCATGTAGGTTGCAGTGGG - Intronic
1082804434 11:57438556-57438578 CAGCTTGGGCTGGTTGTGGCTGG + Intergenic
1084198383 11:67539385-67539407 CAAGTCCAGCAGGTTGTGGTCGG - Intergenic
1088241307 11:107776092-107776114 CAGGAGGTGGAGGTTGTGGTGGG + Intergenic
1090045366 11:123327275-123327297 CAGGAGGTGGAGGTTGTGGTGGG + Intergenic
1092547844 12:9467157-9467179 CAGCTGTTGCAGGTAGGGGTGGG + Intergenic
1093381409 12:18499207-18499229 CAGCTATTGAAGGTTGTTGTTGG - Intronic
1094505140 12:31055205-31055227 CAGCTATTGCAGGTAGGGGTGGG - Intergenic
1095366993 12:41419308-41419330 CAGCTGGTGCAGGCTGCAGTTGG + Intronic
1097241404 12:57578025-57578047 CAGCTTGCGAAGGTTGTGGAGGG - Exonic
1104561745 12:129852071-129852093 GAGGTTGTGCAGGTTGTGGGTGG - Intronic
1107969724 13:45629689-45629711 GAGCTTGTTCAGGTTATGGTTGG + Intergenic
1112964101 13:105165663-105165685 CAGCACCTGCAGGGTGTGTTAGG - Intergenic
1113932262 13:113974640-113974662 CAGCCCCTGCAGGCAGTGGTGGG + Intergenic
1114617535 14:24076225-24076247 CAGGGCCTGCAGGTAGTGGTTGG - Exonic
1118007651 14:61578567-61578589 CAGCTCTCGCAGGTTGTGATAGG + Intronic
1119945153 14:78685704-78685726 CAGGAGGTGGAGGTTGTGGTGGG - Intronic
1120108260 14:80521085-80521107 CAGCTCTTGGAGGCTGAGGTGGG - Intronic
1123660416 15:22559911-22559933 CTGCTCATGAAGGTTGTGGAAGG + Intergenic
1123918740 15:25055919-25055941 CCTCACGTGCTGGTTGTGGTTGG + Intergenic
1125782001 15:42277672-42277694 CAGGAGGTGGAGGTTGTGGTGGG - Intronic
1125930155 15:43594314-43594336 CAGCTCGTACAGGTTCCGGTCGG - Exonic
1125943323 15:43694146-43694168 CAGCTCGTACAGGTTCCGGTCGG - Exonic
1129449113 15:75640076-75640098 CAGCTCGTGCAGGTTGTGGTCGG + Exonic
1132482895 16:175459-175481 CAGCTCCTGCAGGGTGAGGAAGG - Intergenic
1132827734 16:1913480-1913502 CAGGTAGTGCAGGGTGAGGTTGG + Intronic
1135059684 16:19260609-19260631 AAGCTAGTTCAGGCTGTGGTGGG - Intronic
1136128044 16:28199638-28199660 CAGGACGTGGAGGTTGTAGTGGG - Intronic
1136380468 16:29892215-29892237 CAGCTAGTGCAGGTTGGGAAGGG + Intronic
1136649244 16:31652100-31652122 CAGGAGGTGGAGGTTGTGGTGGG + Intergenic
1136778348 16:32883155-32883177 CAGCTGGTGGTGGTGGTGGTGGG + Intergenic
1136892272 16:33978359-33978381 CAGCTGGTGGTGGTGGTGGTGGG - Intergenic
1138365187 16:56469774-56469796 CAGGAGGTGGAGGTTGTGGTGGG + Intronic
1141505161 16:84472118-84472140 CAACTAGTGCAGGTAGTGGCAGG - Intergenic
1203080770 16_KI270728v1_random:1145264-1145286 CAGCTGGTGGTGGTGGTGGTGGG + Intergenic
1143001237 17:3796535-3796557 CAGCACGTGGAGGCTGAGGTTGG + Intronic
1143253921 17:5541946-5541968 CAGCTCGGTCAGGGTCTGGTTGG + Exonic
1147459209 17:40557806-40557828 CAGATAGGGCAGGATGTGGTGGG - Intronic
1150291210 17:63983443-63983465 CAGCTGGGGCAGGCTGTGGGTGG + Intergenic
1152096613 17:78276047-78276069 CAGGAGGTGGAGGTTGTGGTGGG + Intergenic
1154005834 18:10526459-10526481 CTGCTCCTGAAGATTGTGGTGGG + Intronic
1157288134 18:46391356-46391378 CAGCTCTTTCAGGTTGTCCTGGG + Intronic
1158670213 18:59467798-59467820 CAGCTTGTGCAGGGAGTGGCTGG - Intronic
1158787241 18:60729641-60729663 CAGCAGGTGGAGGTTGTAGTGGG - Intergenic
1160770750 19:829672-829694 CAGGTCGTTCAGGTTCTGCTGGG - Exonic
1161301596 19:3545370-3545392 CAGGTCGTGCAGGGCCTGGTGGG - Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1161650382 19:5480608-5480630 CAGGTCGTGCAGGGCCTGGTAGG + Intergenic
1162315653 19:9936593-9936615 CAGCTCGAGCAGGGTCGGGTGGG + Intergenic
1163155306 19:15436963-15436985 CAGCTCCTGCAGGATGTTGATGG + Exonic
1164536309 19:29088620-29088642 CAGCTGGTGGGGGTTGGGGTGGG + Intergenic
1164557274 19:29263334-29263356 CAGCTGGTTCAGGCTGTGATTGG + Intergenic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1167367547 19:49062708-49062730 CAGGAGGTGGAGGTTGTGGTGGG + Intronic
1168046560 19:53798332-53798354 CAGCTCCCGGAGGTTGTGGTTGG + Exonic
1168140723 19:54385014-54385036 CAGCTTGTTCAGGTGGTGGACGG - Intergenic
1168157677 19:54485374-54485396 CAGCTTGTCCAGGTGGTGGACGG + Intergenic
1168714952 19:58521438-58521460 AAGCTCATTCAGGTTGTGGGCGG - Intronic
925976721 2:9146858-9146880 CAGATCCTGCAGGCTGTGGGTGG - Intergenic
926450864 2:13002160-13002182 TAGCACATGCAGGGTGTGGTTGG + Intergenic
934508715 2:94918399-94918421 AAGTTTGTGCTGGTTGTGGTTGG + Intergenic
935547341 2:104415084-104415106 GAGGTCGTGCCGGTGGTGGTGGG + Intergenic
937319351 2:120951737-120951759 CAGCTTCTGCAGGCTTTGGTTGG - Intronic
946221273 2:218229471-218229493 CAGTTTGTGCACGCTGTGGTTGG + Intronic
948831577 2:240600926-240600948 CTGATGGTGCAGGTTGAGGTGGG + Intronic
1170072244 20:12381412-12381434 CAGCTGGAGCTGGTTGTTGTTGG - Intergenic
1172772603 20:37390354-37390376 CAGCTGATGCATGTTGTGCTGGG + Intronic
1172897473 20:38310579-38310601 CAGCTGGAGCAGGTGATGGTGGG - Exonic
1175367778 20:58467451-58467473 CACCTTGTGCAGGTGGTAGTCGG + Exonic
1176168721 20:63687668-63687690 CAGCTCGTGCATGCTGTGGCCGG - Exonic
1177830613 21:26134700-26134722 CAGCTCCTGGAGGTTGGGGAGGG + Intronic
1179925827 21:44533586-44533608 CAGCTCCTGCAGGTGTTGCTCGG + Intronic
1180179701 21:46112438-46112460 CTGCTCCTTCAGGTTCTGGTTGG - Exonic
1181719871 22:24765558-24765580 CAGATCGTGTAGATTGGGGTTGG + Intronic
1183240822 22:36657082-36657104 CAGCTCTCTCAGGTAGTGGTTGG + Intronic
1184341627 22:43889410-43889432 CAGCTCATGCAGGTTGGGGGAGG + Exonic
1184910871 22:47533267-47533289 CAGCTCAAGCAGGTTGTAGATGG - Intergenic
953150010 3:40316187-40316209 CAGGAGGTGGAGGTTGTGGTGGG - Intergenic
953877786 3:46676295-46676317 CAGCTCCTGCAGGTGCTTGTTGG + Exonic
954107635 3:48417974-48417996 CAGCATGTGCAGGATGTGCTGGG - Exonic
954659356 3:52218721-52218743 CAGGTCCTGCAGGAAGTGGTTGG - Intergenic
956946486 3:74229087-74229109 CAGCTTGTGATGTTTGTGGTGGG - Intergenic
957726491 3:84073262-84073284 CAGCTCCTGTGGGTTTTGGTTGG - Intergenic
959711651 3:109391640-109391662 CGGCTGGCGCAGGTTGTAGTGGG + Intergenic
966166508 3:177024836-177024858 CAGTTGGTGCATGTTGTGGAAGG - Exonic
966261619 3:177985153-177985175 CAGGTCATGCAGGGTGTGGTTGG + Intergenic
967764465 3:193263035-193263057 CAGCTCTTGAAGGATGTTGTGGG + Exonic
975889920 4:79015549-79015571 CAGCTCTTGGAGGTGGGGGTGGG - Intergenic
977726449 4:100302228-100302250 CATCAGGGGCAGGTTGTGGTTGG + Intergenic
978534343 4:109745302-109745324 CAGCTCCTGGAGGTTGAGGGGGG - Intronic
990222716 5:53610843-53610865 GATGTGGTGCAGGTTGTGGTGGG + Intronic
993773509 5:91962308-91962330 CTGCTCGTGCAGCCTGGGGTTGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995650510 5:114362834-114362856 CATCTCGTGCAGGTTCCGGCGGG - Exonic
997590212 5:135067771-135067793 CAGATCCTCCAGGCTGTGGTGGG - Intronic
998138282 5:139685791-139685813 AAGCTGGTGCAGGCTGGGGTCGG - Intergenic
998195800 5:140069711-140069733 CAGCTACTGAAGGTTGAGGTAGG + Intergenic
998349338 5:141490822-141490844 CAGATGCTGCAGATTGTGGTGGG + Exonic
999407173 5:151316871-151316893 CAGCTCGTCCAGGGCCTGGTAGG + Exonic
1000130210 5:158289948-158289970 CAGCACATGCAGGTAGTGGTGGG + Intergenic
1001989626 5:176105556-176105578 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1002227244 5:177732582-177732604 CAGGTGGCACAGGTTGTGGTGGG - Intronic
1002266898 5:178041188-178041210 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1002501209 5:179648853-179648875 CAGCTCCTACAGGCTGGGGTGGG + Intergenic
1014445172 6:121518384-121518406 CAGCTCTTGCAGGCTGAAGTGGG + Intergenic
1014514803 6:122365613-122365635 CACCTTGTGCAGGCTATGGTGGG - Intergenic
1018222041 6:161590657-161590679 CAGGAGGTGGAGGTTGTGGTGGG + Intronic
1019179789 6:170178956-170178978 CAGCTGATGCAGGGTGGGGTTGG - Intergenic
1022482630 7:30753836-30753858 CAGCTCCTCCCGGTTGCGGTCGG - Exonic
1023029411 7:36079496-36079518 CAGCAGGTGCAGGCTGTGGAAGG + Intronic
1023836929 7:44073896-44073918 CAGCCCCTGGAGGTTGTGGTAGG + Exonic
1024708142 7:51984416-51984438 CAGCTATTGCAGGATGTGTTAGG + Intergenic
1025868207 7:65405785-65405807 GACCTTGTGCAGCTTGTGGTGGG + Intergenic
1032074474 7:128830078-128830100 CAGCCCGTGCGGGGTGTGGAGGG + Intergenic
1032268014 7:130381844-130381866 CACCTCCTCCAGGGTGTGGTAGG - Exonic
1032471550 7:132182616-132182638 CAGCCCCTGCAGGATGTGGTGGG - Intronic
1034890537 7:154835317-154835339 CAGCTCTTTCAGCTTCTGGTGGG - Intronic
1035762640 8:2080889-2080911 CAGCCCGTGCAGAATGAGGTTGG + Intronic
1038689616 8:29749374-29749396 CAGCTAGGGCACATTGTGGTTGG - Intergenic
1039990901 8:42486938-42486960 CAGGAGGTGGAGGTTGTGGTGGG - Intronic
1041176567 8:55203137-55203159 CAGCTGGTGCCAGTTGTGCTGGG - Intronic
1043525743 8:81094877-81094899 CAGCTGGTGCATGTTATGGCTGG - Intronic
1044928285 8:97227898-97227920 CAGCTAGTGCAGGGGGTGGGGGG + Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1056951418 9:91043408-91043430 CAGCTCTTGCAGCTTATGGGGGG - Intergenic
1186133115 X:6491008-6491030 CAGCTCGTGCGGGTGCTGGCAGG + Intergenic
1187843535 X:23513177-23513199 CAGCTCTTGAAGGTTGTGGAAGG - Intergenic
1190302561 X:49065167-49065189 CTGATCATGCAGGATGTGGTCGG - Intronic
1192267466 X:69548689-69548711 CAGCTAGTGCAGGAGGTGGAGGG + Intergenic
1193845556 X:86466294-86466316 CAGTTCCTGCATGTTGTGGGAGG - Intronic
1197495528 X:127174359-127174381 CAGCCAGTGCAGGATCTGGTGGG + Intergenic
1197839015 X:130725526-130725548 CAGCCCATGCATGTTGAGGTGGG - Intronic