ID: 1129449740

View in Genome Browser
Species Human (GRCh38)
Location 15:75644478-75644500
Sequence CTCTGCTGGTGGCAGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129449740_1129449743 -4 Left 1129449740 15:75644478-75644500 CCTGCAGGCTGCCACCAGCAGAG 0: 1
1: 0
2: 4
3: 21
4: 302
Right 1129449743 15:75644497-75644519 AGAGTCAGCCTGAAAACCACTGG 0: 1
1: 0
2: 2
3: 20
4: 187
1129449740_1129449744 -3 Left 1129449740 15:75644478-75644500 CCTGCAGGCTGCCACCAGCAGAG 0: 1
1: 0
2: 4
3: 21
4: 302
Right 1129449744 15:75644498-75644520 GAGTCAGCCTGAAAACCACTGGG 0: 1
1: 0
2: 1
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129449740 Original CRISPR CTCTGCTGGTGGCAGCCTGC AGG (reversed) Intronic
900967162 1:5966783-5966805 CTCTGCTGCTGCCTGCCTGGAGG - Intronic
901060101 1:6467969-6467991 CTCTTCCTGTGGGAGCCTGCAGG + Exonic
901811325 1:11768214-11768236 CTCAGCTGGAGGCAGCATGGGGG + Exonic
902127631 1:14229880-14229902 CTCTGCTGGAGGCAGGTTGCTGG - Intergenic
903404507 1:23085220-23085242 CTTTGTTGGGGGCAGCCTGTTGG - Exonic
903886167 1:26542331-26542353 CTCTGCGGGTGGATGGCTGCCGG - Intronic
904304754 1:29580887-29580909 TTCTGCTGGCGACAGCCTCCAGG - Intergenic
905215220 1:36401809-36401831 CTGTGCTGGTGGGAGCCTGCAGG + Intergenic
905451876 1:38062232-38062254 CTCTGCTGGAGGCAGCAGGGCGG + Intergenic
905910078 1:41647629-41647651 CCCTGCTGGAGCCAGGCTGCAGG - Intronic
909192767 1:72574629-72574651 CTCTGGTGCTGTCAGCCTGTAGG + Intergenic
912577450 1:110686366-110686388 CTTTGCAGGTGGCCACCTGCTGG + Intergenic
915298804 1:154940479-154940501 TTCTGCCACTGGCAGCCTGCAGG - Intergenic
915557764 1:156669846-156669868 GTCTTCTGTTGGCAGCCTCCAGG - Exonic
915581396 1:156815185-156815207 CTGTGTTGGAGGCAGCCTCCGGG + Exonic
916931791 1:169586402-169586424 CTGGGGTGGTGGCAGCCAGCGGG - Exonic
919407305 1:197201240-197201262 CTCAGCTGCTGGGAGCCAGCGGG - Intergenic
920180213 1:204127822-204127844 GTCCCCTGGTGGCAGCCTGCAGG + Intergenic
920358885 1:205398378-205398400 GCCTGCTGGTGGCAGCCTTTGGG + Intronic
921053017 1:211524595-211524617 CTGTGCCGGTGGCAGGCAGCTGG + Intergenic
921244396 1:213221492-213221514 TTTAGCTGGTGGCAGCCTGAAGG - Intronic
922882479 1:228991142-228991164 CTCAGATGGAGGCAACCTGCTGG + Intergenic
922901272 1:229138654-229138676 CCCTGCTGGTAGCAGGCAGCAGG - Intergenic
923897987 1:238294014-238294036 CTCTGTGGTAGGCAGCCTGCTGG + Intergenic
924907685 1:248473790-248473812 AGCTCCTGGTGTCAGCCTGCTGG + Exonic
924916423 1:248574296-248574318 AGCTCCTGGTGTCAGCCTGCTGG - Exonic
1064423815 10:15213030-15213052 CTCTGGTGGGGGCTGGCTGCTGG + Exonic
1065022363 10:21510488-21510510 CTCTGCTGGTGGCGTCCTCCGGG - Intergenic
1066460384 10:35607965-35607987 CCCTGCTGGAGGCAGCCTTCGGG + Exonic
1067821057 10:49530767-49530789 CTCTGCTGGTGGCAGCTTGAGGG + Exonic
1069579013 10:69552457-69552479 CTCTGCATGGGGCAGCCAGCTGG - Intergenic
1069854527 10:71432674-71432696 TGCTGCTCGTGGCTGCCTGCAGG + Intronic
1072445372 10:95494614-95494636 CTCTGGTGCTGGCTGCCTGAAGG - Intronic
1072789557 10:98308395-98308417 CTCTGCAGGTGACAGCCTCGTGG + Intergenic
1073100833 10:101005792-101005814 CTCTGGGGGTGGCAGGCTGAGGG - Intronic
1073120820 10:101121802-101121824 CTGGGCTGGGGGCAGCCAGCGGG - Intronic
1075058541 10:119238211-119238233 CTGTGCTGGTGACAGCCGGGAGG + Intronic
1075157631 10:119991254-119991276 CGCTGGTGGTGGCAGGGTGCAGG + Intergenic
1075314201 10:121438990-121439012 CTCTGCTTGGAGCAGCCTCCAGG - Intergenic
1076179808 10:128398372-128398394 CTCAGCTGCTGCCAGCTTGCAGG + Intergenic
1076576546 10:131473668-131473690 CTCTGCTGGTGGCCTCCGGTGGG - Intergenic
1077117069 11:889997-890019 CTCTACTGTTCTCAGCCTGCAGG + Intronic
1077597635 11:3547625-3547647 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1078434001 11:11309593-11309615 CTCTGGTGGTGCTAGCCTCCAGG - Intronic
1078615920 11:12866062-12866084 CTCTGCAGTGGGCAGCATGCTGG + Intronic
1081672843 11:44951039-44951061 CTCTCCCGGGGGCCGCCTGCAGG + Intronic
1084253734 11:67923531-67923553 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1084720231 11:70900894-70900916 CATTGCTGGTGTCAGGCTGCTGG + Intronic
1084819143 11:71672395-71672417 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
1085446904 11:76606771-76606793 CTCTCCTCTTAGCAGCCTGCAGG + Intergenic
1087113270 11:94494243-94494265 CCCGGCTGGTGGCAGAGTGCCGG + Intronic
1087380409 11:97398407-97398429 CTGTGGTGGTGGCAGCCTTGAGG - Intergenic
1087544860 11:99572365-99572387 CTGTGCTAGATGCAGCCTGCTGG + Intronic
1088222690 11:107586649-107586671 CTTTACTGATGGCAGCCTCCAGG - Intergenic
1088409875 11:109522565-109522587 GCCTGCTAGTGGCAGCCTGTGGG + Intergenic
1088419232 11:109623872-109623894 CTCAGCTGGAAGCAGCTTGCTGG - Intergenic
1088689212 11:112311071-112311093 ATCTGCTGGTTACAGCCTGGGGG + Intergenic
1089368652 11:117937663-117937685 GTCTGCTGGAGACAGCCTCCTGG - Intergenic
1089734247 11:120538810-120538832 CTCTGCTGATGCCAGGCTGGGGG + Intronic
1090761013 11:129836978-129837000 ATCGACTGGTGGCTGCCTGCTGG + Intronic
1090837252 11:130462489-130462511 CTCTGCAGGTGACTGCCTCCTGG + Exonic
1091541801 12:1469257-1469279 GACAGCTGCTGGCAGCCTGCAGG - Intronic
1092423808 12:8356918-8356940 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
1094297905 12:28928462-28928484 CTGTGTTGGTGGCTGCCTGGTGG + Intergenic
1100082567 12:90871061-90871083 TTCTGCTTGTGAGAGCCTGCAGG + Intergenic
1101623457 12:106414710-106414732 CTCTGCTGCTTGCAGCATACTGG - Intronic
1102207653 12:111101340-111101362 CCCTGCAGGTGGCAGGATGCAGG - Intronic
1102469134 12:113149727-113149749 GCCTGCTGGTGGCTGCCTTCTGG + Intergenic
1103407768 12:120687571-120687593 CTGTGCTGGGCGCAGCCGGCCGG + Intronic
1103607702 12:122099347-122099369 CCCAGCTGTTGGCAGCCAGCGGG + Intronic
1103901219 12:124304463-124304485 GTCTGCTGCTGGCAGCCAGGTGG + Intronic
1103944448 12:124518319-124518341 CTCTGCGGGTGTCATCCTGGAGG - Intronic
1104917480 12:132273390-132273412 CGCTGCTGCTGGCTGCCTCCTGG + Intronic
1105004186 12:132710893-132710915 CGCTGCAGCTGGCGGCCTGCGGG + Exonic
1106802523 13:33270949-33270971 CTCTGCTTGTGGGAGTGTGCAGG - Intronic
1112393180 13:99003603-99003625 CTCAGCAGGTGGCACCCTGGAGG + Intronic
1113338265 13:109397500-109397522 CTCAGCTGATTGCAGCTTGCAGG - Intergenic
1113829967 13:113287954-113287976 CTCAGCTCGTGGCAGCCGGGAGG + Intergenic
1113880694 13:113623890-113623912 CCTTGCCGGTGGCAGCCTACTGG + Intronic
1117325811 14:54668006-54668028 TGCATCTGGTGGCAGCCTGCGGG - Intronic
1117810224 14:59537491-59537513 CTCTGCTAATGGCTGCCTCCAGG + Intronic
1117975156 14:61289866-61289888 CCTTGCTGGTGGTAGTCTGCAGG + Intronic
1118981817 14:70723270-70723292 CTCTCCTGTTTCCAGCCTGCAGG - Intronic
1119612305 14:76073955-76073977 CACTGCTGGTGACAGCCAGCTGG - Intronic
1119948674 14:78721901-78721923 CTCTGCTGGTGGCTGTCACCAGG - Intronic
1121410485 14:93745509-93745531 CTGTGCTGGAGGCATCCAGCAGG + Intronic
1121956114 14:98214920-98214942 CTCTGCTGGGGACAGGCAGCAGG - Intergenic
1123562759 15:21513247-21513269 CACTGCTGGTGGCAGGGGGCAGG - Intergenic
1123599003 15:21950530-21950552 CACTGCTGGTGGCAGGGGGCAGG - Intergenic
1123673745 15:22687909-22687931 CTCTGCTTGCTTCAGCCTGCTGG + Intergenic
1124131059 15:26986010-26986032 CCAGGCTGGTGGCTGCCTGCCGG + Intronic
1124325747 15:28760900-28760922 CTCTGCTTGCTTCAGCCTGCTGG + Intergenic
1124431486 15:29612476-29612498 CTCTGCTGGTAGCAGGCTGAAGG - Intergenic
1125322451 15:38502598-38502620 CTTTGCTGGTAGCAGCATGTGGG + Intronic
1125522255 15:40354797-40354819 GTCTGCTGGTGGTAGCCAGTGGG - Intronic
1128271822 15:66316931-66316953 CTCAGCTGGTGGGACCATGCAGG - Intronic
1128304528 15:66589254-66589276 CACAGCTGGTGCCAGCCAGCAGG + Intronic
1129226794 15:74174843-74174865 CTCTGCAGGAGGCACCATGCAGG + Exonic
1129449740 15:75644478-75644500 CTCTGCTGGTGGCAGCCTGCAGG - Intronic
1129689871 15:77707103-77707125 CTCAGCAGGTGGCAGGCTGCAGG + Intronic
1131167088 15:90150041-90150063 CTGCGGTGGTGGCAGCTTGCAGG + Intergenic
1131378670 15:91946242-91946264 CTCAGCTGGTGTCACCCAGCTGG + Intronic
1132110439 15:99098834-99098856 CTCTGATGGTGGGAGCCAGGAGG + Intronic
1202971110 15_KI270727v1_random:240380-240402 CACTGCTGGTGGCAGGGGGCAGG - Intergenic
1132593154 16:735224-735246 CACAGCTGGACGCAGCCTGCTGG + Intronic
1132681105 16:1142062-1142084 CGGGGCTGGGGGCAGCCTGCAGG + Intergenic
1132772782 16:1573718-1573740 CTCTGCTGGTGGCTGCTGCCTGG + Intronic
1132949225 16:2551226-2551248 CCTTGGTGGTGGCAGCCTGAGGG + Intronic
1132965363 16:2650902-2650924 CCTTGGTGGTGGCAGCCTGAGGG - Intergenic
1133374469 16:5273022-5273044 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
1134229803 16:12419955-12419977 CTGAGCTGTGGGCAGCCTGCAGG - Intronic
1136283207 16:29226310-29226332 CTCAGCTGGTGGAAGCGTTCGGG + Intergenic
1137629297 16:49930988-49931010 CCCTGCTGGGGGGTGCCTGCTGG + Intergenic
1137725520 16:50654131-50654153 CGCAGCTGGTGGCATCCAGCAGG + Intergenic
1140776016 16:78249573-78249595 CTCGGCTGGTTTCAGCATGCAGG + Intronic
1140925730 16:79581459-79581481 CTCTGCTGCTGGCAGCACCCAGG + Intergenic
1142030067 16:87834140-87834162 GTCCGCTGGTGGCAGCCAGCAGG + Intronic
1142373814 16:89696842-89696864 CTCTGCTGGAGCCAATCTGCGGG - Exonic
1142917572 17:3154394-3154416 CCTTCCTGGTGACAGCCTGCTGG - Intergenic
1143245290 17:5479769-5479791 CTATTCTGGTAGGAGCCTGCTGG - Intronic
1143815230 17:9507250-9507272 GTCTGCCAGGGGCAGCCTGCAGG - Intronic
1143905399 17:10204940-10204962 CACTGCTGGTGAGAGCCTGTTGG + Intergenic
1145764884 17:27451707-27451729 CTCTCCATGTGGCAGCCTGAGGG + Intergenic
1145978527 17:28998023-28998045 CTCAGCAGGTGGCTGCCTGGGGG + Intronic
1148823722 17:50376844-50376866 CCCTGCTGGTGACACCCAGCTGG + Intronic
1149623958 17:58066596-58066618 GGCTGCTGTTGGCAGCATGCTGG + Intergenic
1149875085 17:60224573-60224595 CTGTGCTGGTTGCAGTCTTCTGG - Intronic
1150560214 17:66288176-66288198 CTCTGCTGCTGCCAGTCTCCAGG - Intergenic
1151312924 17:73305232-73305254 CTCTGCTGGTGGCTGGCTTCGGG - Intronic
1152181115 17:78822428-78822450 CTCTGCTGGTCACAGACAGCTGG + Intronic
1152219015 17:79050720-79050742 ATCAGCTGTTTGCAGCCTGCTGG - Intergenic
1152536375 17:80952445-80952467 TTCTGCTGCAGGGAGCCTGCAGG + Intronic
1152558271 17:81065406-81065428 CCCTGGTGGTGCCAGCCTCCAGG - Intronic
1152563840 17:81091421-81091443 CTATGCTGGGGGCAGCCCGGGGG + Intronic
1154272656 18:12933256-12933278 CTATGCAGATGGCAGCCTCCTGG + Intergenic
1154416131 18:14177024-14177046 CACTGCTGGTGGCAGGGGGCAGG - Intergenic
1155248861 18:23936979-23937001 CTAAGCTGGTAGCAGCCTGTGGG + Intronic
1159532009 18:69666815-69666837 CCCTGCTGATGGCAGCCTGCAGG - Intronic
1160037032 18:75310877-75310899 CTTTGCTGATGGCAGCCCCCTGG + Intergenic
1160438135 18:78867031-78867053 CACTGCTGCTGGCTGCCTGCGGG - Intergenic
1161787098 19:6333571-6333593 CTCTGCCGGGCGCAGCCGGCTGG - Exonic
1162015384 19:7844013-7844035 CTCTGCTGGTGGACGGCTCCCGG + Intronic
1164578297 19:29418864-29418886 GCCTGCTGGTGGCAGCCTGTTGG + Intergenic
1164681818 19:30139606-30139628 AAGTGCTGGTGGCAGCTTGCGGG + Intergenic
1164752724 19:30668641-30668663 CTCTGCTGATGGCTCCCTGGGGG + Intronic
1166990574 19:46690253-46690275 CCCTCCAGATGGCAGCCTGCGGG + Intronic
1168309839 19:55454886-55454908 CCCTGGAGGCGGCAGCCTGCTGG + Intronic
1168474332 19:56665042-56665064 CCCTGCTGGGGACAGCATGCAGG - Exonic
925112943 2:1352025-1352047 CTCTGCTGGTACCACTCTGCAGG - Intronic
925125562 2:1453430-1453452 GTCTGGAGGTGGCTGCCTGCAGG - Intronic
925175370 2:1779811-1779833 CTCTGCTGGTGAGTGTCTGCTGG - Intergenic
925175391 2:1780035-1780057 CTCTGCTGGTGGTGCTCTGCTGG - Intergenic
925255592 2:2484142-2484164 CCCTGCTGGGGGCAGGCTACTGG - Intergenic
925344487 2:3161007-3161029 CTCTGTTGGCTGCATCCTGCTGG + Intergenic
925416440 2:3673087-3673109 TGCTGCTGGAGGCAGCTTGCTGG + Intronic
926108274 2:10166027-10166049 AGCTGCTGGTGACAGCTTGCTGG + Intronic
926116938 2:10219377-10219399 CTCAGCTGGTGGGAGGCAGCAGG - Intergenic
926329323 2:11811581-11811603 CTCTGCAGGTGGCAGCTTTTAGG + Intronic
926547061 2:14255276-14255298 CCCTGCTGATGGGCGCCTGCAGG + Intergenic
927494851 2:23545519-23545541 CTCTGCGGGTGTCAGCCTCCTGG - Intronic
928123740 2:28602252-28602274 TTCTGGTGGTGGCAGCCAGGTGG + Intronic
929235866 2:39605083-39605105 CTCAGCTGTTGCAAGCCTGCAGG + Intergenic
929445799 2:42000159-42000181 CTCTGCTGGTCTCACCCTTCTGG + Intergenic
929560099 2:42951141-42951163 CTCAGCAGGAGGAAGCCTGCAGG + Intergenic
932830075 2:74980821-74980843 CTTCATTGGTGGCAGCCTGCTGG + Intergenic
934777647 2:96949458-96949480 CTCTGCTGCTGTCTCCCTGCAGG - Intronic
934947018 2:98549708-98549730 CTCTGCTGGTGGCATCTGACAGG + Intronic
937221794 2:120346229-120346251 TTCTGCTGCTGGCGGCCGGCTGG + Exonic
937304685 2:120864096-120864118 GAGTCCTGGTGGCAGCCTGCAGG + Intronic
937516508 2:122661471-122661493 CTCTCCTGGAGGCCGGCTGCAGG + Intergenic
937798915 2:126058950-126058972 CTCTGCTGGTGGTAGCAGGGAGG + Intergenic
938086610 2:128406079-128406101 CTCTGCATGTGCCAGCCTGGAGG - Intergenic
938191160 2:129281978-129282000 CTCTGCAGGTCACTGCCTGCTGG - Intergenic
938305961 2:130254076-130254098 CACTGCTGGGGGCAAGCTGCTGG - Intergenic
938312430 2:130301866-130301888 CACTGTTGGTGGCAGGCAGCAGG + Intergenic
938448193 2:131393695-131393717 CACTGCTGGGGGCAAGCTGCTGG + Intergenic
941927019 2:170906044-170906066 CTCTGCTGGTCTCACCCAGCAGG + Intergenic
942046108 2:172100415-172100437 CACTGCAGGTCGCAGCCTGCAGG + Exonic
942348318 2:175026682-175026704 CTCTTCTGGAGTCAGACTGCTGG + Intergenic
948363316 2:237437793-237437815 ATCTGGAGCTGGCAGCCTGCGGG - Intergenic
948718935 2:239883918-239883940 CTCTCCTGGTGACTGCCAGCAGG - Intergenic
948887208 2:240890269-240890291 GTCTGCTGGTGGGACCCAGCCGG + Intronic
949018090 2:241724867-241724889 CTCTCCTGGTGCCCTCCTGCCGG + Intronic
1168803526 20:659626-659648 CTGTGCTGGTGGCACAATGCTGG - Intronic
1169793169 20:9433161-9433183 CTCAGGAGGTGGCAGCTTGCAGG - Intronic
1170740167 20:19049211-19049233 CGCTGCTGCTGACAGCCTTCTGG - Intergenic
1171358108 20:24566188-24566210 CCCTGGTGGTGGCAGCCAGCAGG - Intronic
1172046492 20:32084265-32084287 CTCTGATGGTGGCAACCAGGTGG + Intronic
1172749535 20:37240557-37240579 CTCTGCTTGCTGGAGCCTGCTGG + Intronic
1173395887 20:42678983-42679005 CTCTGCTGGAAGAAACCTGCTGG - Intronic
1173950822 20:46992023-46992045 TCCTACTGGTGGCAGCCAGCGGG - Intronic
1174385938 20:50188892-50188914 CTCCCCAAGTGGCAGCCTGCAGG + Intergenic
1174560495 20:51427626-51427648 CACTGCTGCTGAAAGCCTGCGGG + Intronic
1175612403 20:60362754-60362776 TGCTGCTGCTGCCAGCCTGCAGG + Intergenic
1175626383 20:60491454-60491476 CCCTGCTGTTCCCAGCCTGCAGG + Intergenic
1175958605 20:62623844-62623866 CTGGGCTGGTCTCAGCCTGCAGG - Intergenic
1176447138 21:6830500-6830522 CGCTGCTGGTGGGAGCCACCTGG + Intergenic
1176736066 21:10548087-10548109 GCCTGCTGGGGGCAGCCTGTGGG - Intronic
1176825308 21:13695526-13695548 CGCTGCTGGTGGGAGCCACCTGG + Intergenic
1176857213 21:13982270-13982292 CACTGCTGGTGGCAGGGGGCGGG + Intergenic
1177171533 21:17661130-17661152 CTTTGCTGGTGCCAGCTTGGCGG + Intergenic
1179766004 21:43573679-43573701 CTGTGCTGGTGGCGTCCTGGGGG + Intronic
1180128092 21:45805475-45805497 CTCTGCTGGTGGGAACCTTGAGG - Intronic
1181082423 22:20424207-20424229 AGCTGTTGGTGGCAGCTTGCGGG - Intergenic
1181508775 22:23379586-23379608 AACTGATGGGGGCAGCCTGCAGG - Intergenic
1181630883 22:24150733-24150755 CTCCGCTGGTGGAAGAGTGCTGG + Intronic
1183533082 22:38374784-38374806 GCCTGCTGGGGGCAGCCTGTGGG + Intronic
1183827312 22:40398477-40398499 CTCTGCTACAAGCAGCCTGCAGG + Intronic
1184193504 22:42910746-42910768 CTCGGCTGGTGGCATCCTTCTGG - Intronic
1184243928 22:43226540-43226562 GTCAGCTGGCGGCAGCCTTCGGG + Intronic
1184686955 22:46100556-46100578 CTCAGGAGGTGGCATCCTGCTGG + Intronic
1184871267 22:47239966-47239988 CGCTGCAGGTGCCAGCCTCCAGG + Intergenic
1185068093 22:48641998-48642020 CGCTGAGGGGGGCAGCCTGCTGG + Intronic
1185161860 22:49234759-49234781 CTCTGCTGGCCTCAGGCTGCTGG - Intergenic
1185216471 22:49602568-49602590 CGGTGCTGGTGTCCGCCTGCCGG - Intronic
950429698 3:12943775-12943797 CTCTGCTCCAGGCCGCCTGCTGG - Intronic
950693288 3:14677912-14677934 TTCTGCTGCTGGCAGCGTGGAGG - Intronic
950752809 3:15144260-15144282 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
952818605 3:37466810-37466832 CTTTGTTGATGGCAGCCTGTTGG + Intronic
953742490 3:45549560-45549582 CCATGCTGGTGTCAGCCAGCTGG - Intergenic
953884062 3:46705729-46705751 CTCAGCTGGTTCCAGCCAGCTGG + Intronic
954429131 3:50459910-50459932 CTCTGGTGGGAGCAGGCTGCAGG - Intronic
955017886 3:55089595-55089617 CTCTGCTGCTGACTGGCTGCGGG - Intergenic
957067804 3:75540003-75540025 CTTTGCTGGTGGCAGTGGGCTGG - Intergenic
961285352 3:125797977-125797999 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
962207433 3:133446532-133446554 CTCTGATAGGGGGAGCCTGCAGG - Intronic
963131273 3:141860474-141860496 CTCTGCTAGTACCAGCCTGTTGG + Intergenic
964224541 3:154383059-154383081 CATTGCTGGGGCCAGCCTGCAGG + Intronic
964542007 3:157789909-157789931 CCTTTCTGGGGGCAGCCTGCAGG - Intergenic
967083248 3:186070306-186070328 CTCTGCAGCTGGCAGGCTGGTGG + Intronic
967837652 3:193978158-193978180 ATCTGCTGGTGCCATCCTGAGGG - Intergenic
968500797 4:949004-949026 CTGTGCTGCTTGCTGCCTGCTGG - Intronic
968954002 4:3708963-3708985 CAGTGCTGGTGGCAGCGGGCTGG + Intergenic
969398451 4:6938244-6938266 CTCTTCTGGGGGCTGCCTGGTGG + Intronic
969438458 4:7202103-7202125 CTGTGCTTGTGGGAACCTGCTGG - Intronic
969741709 4:9033158-9033180 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
969801076 4:9566055-9566077 CTTTGCTGGTGGCAGTGGGCTGG + Intergenic
975403598 4:73965145-73965167 CTTTGCTGGTGTCTGCCTGCAGG - Intergenic
977418276 4:96763747-96763769 CAATGGTGGTGGCAGCATGCTGG + Intergenic
977634766 4:99284575-99284597 ACCTGCTGGTGCCATCCTGCAGG + Exonic
978593941 4:110356444-110356466 CTCTGCGGGAGGGAGCATGCAGG - Intergenic
978683820 4:111415314-111415336 CTTAGCTGTTGGCAGCCTTCAGG - Intergenic
978852478 4:113355254-113355276 CTCTCCGTGTGGCAGCCTGATGG + Exonic
982437944 4:155399390-155399412 CTCTTCATGTGGCAGCCTGAGGG + Intergenic
985229534 4:187799623-187799645 CTGTGGTGGTGGCAGCCACCAGG + Intergenic
985614575 5:911724-911746 CCTTCCTGTTGGCAGCCTGCTGG + Intronic
987301213 5:16599665-16599687 CTCTGCTGGAAGCAGCATTCAGG + Intronic
988437935 5:31197265-31197287 CTCTTCTGCTGACAGCCTGCAGG + Intronic
988602711 5:32654719-32654741 CTGTGCTGATGGCAGCCAGGAGG - Intergenic
991200768 5:63988803-63988825 CTGTGCTGCATGCAGCCTGCAGG - Intergenic
991642641 5:68770146-68770168 CTTTGCAGGTGGTAGCCTGAAGG - Intergenic
995943158 5:117609304-117609326 CTCTGCTGGGTGCTGCCTTCTGG + Intergenic
998298299 5:140993065-140993087 CCCTGCTGATTGCAGACTGCAGG - Intronic
1000028959 5:157385131-157385153 CACTGCTGCTGTCATCCTGCAGG + Intronic
1001488035 5:172133865-172133887 CTCTCCAGGTGGCAGACTCCAGG + Intronic
1002643042 5:180639716-180639738 CTCTGGACGTGGCAGGCTGCAGG - Intronic
1002767948 6:259152-259174 CTCTGTTGGTGGGACCATGCTGG - Intergenic
1003371340 6:5529931-5529953 GTCTGGTGTTGGCTGCCTGCTGG - Intronic
1003704955 6:8515462-8515484 CTTTGCTGTTGGCATCTTGCTGG + Intergenic
1003939072 6:11006187-11006209 CTCTGCTGTCTGCAGCCTCCAGG - Intronic
1004032467 6:11884206-11884228 CTGTGCTGGGGGCAGCCTGTGGG + Intergenic
1004064406 6:12228832-12228854 CTGTGCAGGTGGCATCCTACAGG - Intergenic
1004414662 6:15414674-15414696 CTGTGCTGGTGGGACCCTGAAGG + Intronic
1005450606 6:25968037-25968059 CTTTGCTGTTGGCAGCATGGAGG + Intronic
1005813286 6:29531923-29531945 CTCTGGGAGTAGCAGCCTGCAGG + Intergenic
1006193290 6:32222483-32222505 CGCTGCTGGGGGCAGCCAGGAGG - Intronic
1007232222 6:40356258-40356280 CTCTGCTCTAGGGAGCCTGCAGG - Intergenic
1007692985 6:43714805-43714827 CTCAGCCAGTGGCTGCCTGCAGG - Intergenic
1009624913 6:66126787-66126809 TTTTGCTAGTGGCAGCCAGCTGG + Intergenic
1011227780 6:85126907-85126929 CTCTGCTTGGGACAGCCTGTTGG - Intergenic
1011584384 6:88908909-88908931 GTGTTCTGCTGGCAGCCTGCTGG + Intronic
1013476378 6:110510891-110510913 CTCTGCTCTTGGGACCCTGCTGG + Intergenic
1014285602 6:119494079-119494101 CTCAGCTTGTTCCAGCCTGCAGG - Intergenic
1016916894 6:149252329-149252351 CTCAGCTCATGGCAGCCTCCCGG - Intronic
1017361126 6:153573153-153573175 TTCTCCCGGTGGGAGCCTGCTGG - Intergenic
1017905559 6:158755554-158755576 CTCTGTTGGGGGCTGCCTGTAGG - Intronic
1019363139 7:616211-616233 CTGTGCTGGAGGCAGCCCCCTGG + Intronic
1019517649 7:1446876-1446898 CCCTCCTGGTGGCAGCCCACAGG + Intronic
1019792961 7:3029298-3029320 CTGGGCAGGTGGCAGCCTGAAGG - Intronic
1020002098 7:4761971-4761993 CTCTGCTGGCTCCAGCCTGTTGG - Intronic
1020034735 7:4958147-4958169 GTCTGCTGGGAGCAGCCCGCGGG - Intronic
1023715470 7:43039491-43039513 CCCAGCTGCTGGCACCCTGCTGG - Intergenic
1023871298 7:44264347-44264369 GTGTGGTGGTGGCAGCCTGGGGG + Intronic
1024111726 7:46154097-46154119 CTCTCCTGAGGGCAGCCTGGAGG + Intergenic
1025095330 7:56091823-56091845 CTCTGCTGGTGCCAGGCCCCTGG + Intronic
1030513006 7:110508041-110508063 CTCTGATTGTGGCAGCCACCTGG - Intergenic
1034318661 7:150159240-150159262 TTCTCCAGGTGGCAGCCTGCAGG - Intergenic
1034774095 7:153807972-153807994 TTCTCCAGGTGGCAGCCTGCAGG + Intergenic
1034982429 7:155487658-155487680 GTCTGCTGGAGACAGCATGCTGG - Intronic
1034996631 7:155581420-155581442 CTCTGCAGGTGCCAGCACGCTGG - Intergenic
1035141468 7:156766736-156766758 AGCTGCTGGTGACAGTCTGCAGG + Intronic
1035599749 8:890662-890684 CTCTGCTGGTGGCACCGGGTGGG - Intergenic
1036246909 8:7125755-7125777 CTTTGCTGGTGGCAGTTGGCTGG + Intergenic
1036614795 8:10379786-10379808 TTCTGCCAGTGGCAGTCTGCAGG + Intronic
1036788720 8:11704073-11704095 CTCCGCTGGGCGCAGGCTGCGGG - Intronic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1041119622 8:54572802-54572824 CCCTGCTGGTCCCACCCTGCTGG + Intergenic
1041145368 8:54870562-54870584 CTCTGCTGCTCTCTGCCTGCAGG - Intergenic
1044603609 8:94030215-94030237 CTCTGCTGGTAACTCCCTGCAGG - Intergenic
1045258390 8:100549633-100549655 CTCTGGTGGTGGCAGGGTGGGGG - Intronic
1046929096 8:119825102-119825124 CTTTGCAGGTTGCAGCCTCCCGG - Intronic
1049171084 8:141161085-141161107 CTCTCCTGGTGACCCCCTGCAGG + Intronic
1049558105 8:143293650-143293672 CTCTACTGGATCCAGCCTGCAGG - Intronic
1049732345 8:144185150-144185172 CGCTCCTGCAGGCAGCCTGCCGG + Intronic
1050976085 9:11940368-11940390 CTGGGCTGGATGCAGCCTGCAGG + Intergenic
1051604738 9:18908246-18908268 CCCTGCTGTTGGCAGCCTTGGGG + Intronic
1052541519 9:29817063-29817085 GCCTGCTGGGGGCAGCCTGTAGG - Intergenic
1053141440 9:35685135-35685157 CTCGGCTGGGGGCAGCGGGCAGG + Exonic
1054803565 9:69376964-69376986 CTGTGCTGGTGGGAGGCTGTGGG + Intronic
1056130862 9:83585187-83585209 CTCTGGCGGTGGCATCCTGCAGG - Intergenic
1056291479 9:85148198-85148220 CTCTGTTGGTGTGAGCCAGCAGG + Intergenic
1057334387 9:94144326-94144348 CTGGGCTGGGGGCTGCCTGCAGG - Intergenic
1060198959 9:121640723-121640745 CTCTGCTGCTGGGAACCTGTGGG + Intronic
1060434537 9:123582252-123582274 CTCTAGAGGTGGCAGCGTGCTGG + Intronic
1062014030 9:134282366-134282388 CCCTGCTGGAGGCAGCCTCAAGG - Intergenic
1062032499 9:134368041-134368063 CTCTGGAGGTGCCAGCTTGCAGG + Intronic
1062421822 9:136486283-136486305 CTCTGCTGGGGGCTCCCTGGAGG - Intergenic
1203759024 EBV:2398-2420 GGCTGCTGGTGGCAGACAGCTGG + Intergenic
1203522052 Un_GL000213v1:54031-54053 CGCTGCTGGTGGGAGCCACCTGG - Intergenic
1186485110 X:9928214-9928236 CACTGCTGCTTGGAGCCTGCCGG + Intronic
1186509122 X:10117356-10117378 CTCTGCTTGTGGAAGCCCGAGGG - Exonic
1187885267 X:23883384-23883406 TTCTGCTGTTGGTGGCCTGCCGG - Intronic
1191766608 X:64705252-64705274 TTCTGCTGGTTGATGCCTGCTGG + Intergenic
1198430759 X:136564487-136564509 CTGTGCTGGTGGCAGCCATGGGG - Intergenic
1199295512 X:146153433-146153455 CTCTGCTGGGGGCAGCCTGAAGG + Intergenic
1199597822 X:149522082-149522104 CTCAGCTGGTGGAAGCATCCAGG - Intronic
1200162335 X:154015977-154015999 CACAGCTGCTGGCAGCCAGCAGG - Intronic
1202594357 Y:26521237-26521259 TCCTGCTGGGGGCAGCCTGTGGG - Intergenic