ID: 1129449781 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:75644727-75644749 |
| Sequence | CAGGCTGATCTCAAACTCCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 92278 | |||
| Summary | {0: 884, 1: 12151, 2: 22105, 3: 30653, 4: 26485} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1129449781_1129449790 | 21 | Left | 1129449781 | 15:75644727-75644749 | CCCAGGAGTTTGAGATCAGCCTG | 0: 884 1: 12151 2: 22105 3: 30653 4: 26485 |
||
| Right | 1129449790 | 15:75644771-75644793 | CTATACAAAAATACAAAAGTTGG | 0: 1 1: 2 2: 52 3: 296 4: 1081 |
||||
| 1129449781_1129449791 | 25 | Left | 1129449781 | 15:75644727-75644749 | CCCAGGAGTTTGAGATCAGCCTG | 0: 884 1: 12151 2: 22105 3: 30653 4: 26485 |
||
| Right | 1129449791 | 15:75644775-75644797 | ACAAAAATACAAAAGTTGGCTGG | 0: 2 1: 60 2: 1971 3: 16978 4: 120628 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1129449781 | Original CRISPR | CAGGCTGATCTCAAACTCCT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||