ID: 1129449781

View in Genome Browser
Species Human (GRCh38)
Location 15:75644727-75644749
Sequence CAGGCTGATCTCAAACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92278
Summary {0: 884, 1: 12151, 2: 22105, 3: 30653, 4: 26485}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129449781_1129449790 21 Left 1129449781 15:75644727-75644749 CCCAGGAGTTTGAGATCAGCCTG 0: 884
1: 12151
2: 22105
3: 30653
4: 26485
Right 1129449790 15:75644771-75644793 CTATACAAAAATACAAAAGTTGG 0: 1
1: 2
2: 52
3: 296
4: 1081
1129449781_1129449791 25 Left 1129449781 15:75644727-75644749 CCCAGGAGTTTGAGATCAGCCTG 0: 884
1: 12151
2: 22105
3: 30653
4: 26485
Right 1129449791 15:75644775-75644797 ACAAAAATACAAAAGTTGGCTGG 0: 2
1: 60
2: 1971
3: 16978
4: 120628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129449781 Original CRISPR CAGGCTGATCTCAAACTCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr