ID: 1129449785

View in Genome Browser
Species Human (GRCh38)
Location 15:75644746-75644768
Sequence GGCTTTTCACTATGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184083
Summary {0: 2, 1: 54, 2: 1800, 3: 27460, 4: 154767}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129449785_1129449793 15 Left 1129449785 15:75644746-75644768 CCTGGGCAACATAGTGAAAAGCC 0: 2
1: 54
2: 1800
3: 27460
4: 154767
Right 1129449793 15:75644784-75644806 CAAAAGTTGGCTGGATGTGGTGG 0: 1
1: 82
2: 2391
3: 25897
4: 69823
1129449785_1129449794 18 Left 1129449785 15:75644746-75644768 CCTGGGCAACATAGTGAAAAGCC 0: 2
1: 54
2: 1800
3: 27460
4: 154767
Right 1129449794 15:75644787-75644809 AAGTTGGCTGGATGTGGTGGCGG 0: 1
1: 23
2: 741
3: 8788
4: 26874
1129449785_1129449791 6 Left 1129449785 15:75644746-75644768 CCTGGGCAACATAGTGAAAAGCC 0: 2
1: 54
2: 1800
3: 27460
4: 154767
Right 1129449791 15:75644775-75644797 ACAAAAATACAAAAGTTGGCTGG 0: 2
1: 60
2: 1971
3: 16978
4: 120628
1129449785_1129449790 2 Left 1129449785 15:75644746-75644768 CCTGGGCAACATAGTGAAAAGCC 0: 2
1: 54
2: 1800
3: 27460
4: 154767
Right 1129449790 15:75644771-75644793 CTATACAAAAATACAAAAGTTGG 0: 1
1: 2
2: 52
3: 296
4: 1081
1129449785_1129449795 19 Left 1129449785 15:75644746-75644768 CCTGGGCAACATAGTGAAAAGCC 0: 2
1: 54
2: 1800
3: 27460
4: 154767
Right 1129449795 15:75644788-75644810 AGTTGGCTGGATGTGGTGGCGGG 0: 1
1: 25
2: 708
3: 8744
4: 30055
1129449785_1129449792 12 Left 1129449785 15:75644746-75644768 CCTGGGCAACATAGTGAAAAGCC 0: 2
1: 54
2: 1800
3: 27460
4: 154767
Right 1129449792 15:75644781-75644803 ATACAAAAGTTGGCTGGATGTGG 0: 1
1: 66
2: 2289
3: 23906
4: 54395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129449785 Original CRISPR GGCTTTTCACTATGTTGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr