ID: 1129449790

View in Genome Browser
Species Human (GRCh38)
Location 15:75644771-75644793
Sequence CTATACAAAAATACAAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1432
Summary {0: 1, 1: 2, 2: 52, 3: 296, 4: 1081}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129449781_1129449790 21 Left 1129449781 15:75644727-75644749 CCCAGGAGTTTGAGATCAGCCTG 0: 884
1: 12151
2: 22105
3: 30653
4: 26485
Right 1129449790 15:75644771-75644793 CTATACAAAAATACAAAAGTTGG 0: 1
1: 2
2: 52
3: 296
4: 1081
1129449785_1129449790 2 Left 1129449785 15:75644746-75644768 CCTGGGCAACATAGTGAAAAGCC 0: 2
1: 54
2: 1800
3: 27460
4: 154767
Right 1129449790 15:75644771-75644793 CTATACAAAAATACAAAAGTTGG 0: 1
1: 2
2: 52
3: 296
4: 1081
1129449782_1129449790 20 Left 1129449782 15:75644728-75644750 CCAGGAGTTTGAGATCAGCCTGG 0: 1506
1: 22882
2: 43462
3: 59071
4: 50229
Right 1129449790 15:75644771-75644793 CTATACAAAAATACAAAAGTTGG 0: 1
1: 2
2: 52
3: 296
4: 1081

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129449790 Original CRISPR CTATACAAAAATACAAAAGT TGG Intronic
900382261 1:2390908-2390930 CTACTAAAAAATACAAAAATTGG - Intronic
901089321 1:6630873-6630895 CTCTACAAAAAAAAAAAAGTGGG - Intronic
901115360 1:6839557-6839579 CAATACAAAAGTAAACAAGTAGG + Intronic
901284131 1:8063047-8063069 CTACAAAAAAATACAAAAATTGG + Intergenic
901374417 1:8827363-8827385 ATCTACAAAAATACAAAAATTGG + Intergenic
901432974 1:9229138-9229160 CTACTAAAAAATACAAAAATGGG + Intergenic
901502478 1:9661694-9661716 CTACAAAAAAATACAAAAATTGG + Intronic
901520834 1:9783690-9783712 CACTAAAAAAATACAAAAATTGG + Intronic
901538141 1:9896666-9896688 CTACTAAAAAATACAAAAATTGG + Intronic
901556744 1:10037718-10037740 CTAGAAAAAAATACAAAAATTGG - Intronic
901588790 1:10321482-10321504 TTTTAAATAAATACAAAAGTAGG + Intronic
901738340 1:11326473-11326495 CTAAAAAAAAAAAAAAAAGTAGG - Intergenic
901942285 1:12672192-12672214 CTAAGCAAAAATAACAAAGTTGG - Intergenic
902165137 1:14564033-14564055 CTCTACTAAAATACAAAAATTGG - Intergenic
902281077 1:15375022-15375044 CTCTACTAAAATATAAAAATTGG - Intronic
902544545 1:17181722-17181744 TAAAACAAAAATCCAAAAGTTGG + Intergenic
902570319 1:17342808-17342830 CTACTAAAAAATACAAAAATTGG + Intronic
902600303 1:17536313-17536335 CTACAAAAAAATACAAAAATTGG + Intergenic
902667109 1:17947289-17947311 CTACAGAAAAATACAAAAATTGG - Intergenic
903080733 1:20810140-20810162 AAATACAAAAATACAAAAATTGG - Intronic
903242378 1:21991953-21991975 CTACTAAAAAATACAAAATTAGG + Intronic
903311336 1:22459186-22459208 CTATATAAAGATATAAAACTTGG - Intronic
903509300 1:23862329-23862351 CTACTAAAAAATACAAAAATTGG - Intronic
903632665 1:24788150-24788172 CTACTAAAAAATACAAAAATTGG - Intronic
903713426 1:25344078-25344100 CTCTACCAAAATACAAAAATTGG + Intronic
903799151 1:25953671-25953693 CTCTACTAAAATACAAAAATTGG + Intergenic
903867176 1:26408372-26408394 CTCTATAAAAATACAAAAATTGG + Intergenic
903900841 1:26644064-26644086 GTGTACAAAAATACAAATATTGG + Intergenic
903955204 1:27020794-27020816 CTACCAAAAAATACAAAAATTGG - Intergenic
904146439 1:28395962-28395984 CTGTTCAAAAAAAAAAAAGTTGG - Intronic
904201656 1:28823692-28823714 CTACTAAAAAATACAAAAATTGG - Intronic
904242551 1:29158004-29158026 CTCTACTAAAATACAAAAATTGG + Intronic
904258590 1:29273567-29273589 CTCTACAAAAAATAAAAAGTTGG - Intronic
904524376 1:31121656-31121678 CTCTACTAAAATACAAAAACTGG + Intergenic
904640296 1:31922182-31922204 CTTTTAAAAAATAAAAAAGTTGG + Intronic
904708787 1:32412771-32412793 CTCAAAAAAAATAAAAAAGTGGG + Intergenic
904771413 1:32883336-32883358 CTACAAAAAAATGCAAAAATTGG - Intergenic
904798497 1:33075670-33075692 CTCTACTAAAATACAAAAAATGG - Intronic
905056714 1:35100967-35100989 CTACAAAAAAATACAAAAACTGG - Intronic
905467647 1:38167434-38167456 TTAAACAAAAATACCAATGTGGG + Intergenic
905647415 1:39634082-39634104 CAAAACAAACAAACAAAAGTTGG - Intronic
905996587 1:42386574-42386596 CTCTATAAAAATAAAAAATTGGG + Intronic
906131101 1:43457339-43457361 CTCGACAAAAATATAAAAATTGG + Intergenic
906855440 1:49299095-49299117 CTAAAAAAAAATCCAAAAGTAGG + Intronic
906954156 1:50358719-50358741 CTCTACTAAAATACAAAAATTGG + Intergenic
907173978 1:52500460-52500482 CTCTACAAAAATAAAAAATTAGG + Intronic
907544977 1:55252076-55252098 CTCTACAAAAAAAAAAAAATTGG - Intergenic
907574519 1:55514110-55514132 CTACTAAAAAATACAAAAATTGG + Intergenic
907753391 1:57285428-57285450 AAATACAAAAATACAAAAATAGG - Intronic
907840294 1:58150589-58150611 CTAAAAAAAAAAAAAAAAGTGGG + Intronic
908230852 1:62103586-62103608 CTACTAAAAAATACAAAAATTGG + Intronic
908243892 1:62212232-62212254 CTACAAAAAAATACAAAAAGAGG + Exonic
908287623 1:62624806-62624828 CTACTAAAAAATACAAAAATTGG + Intronic
908754363 1:67454572-67454594 CTATAAATAAATACAAACCTTGG + Intergenic
909414601 1:75391402-75391424 CTAAACAAAAAGAACAAAGTTGG + Intronic
909456106 1:75851272-75851294 TCATAAAAAAATACAAAAGAAGG - Intronic
909509257 1:76432755-76432777 TTATAAGAGAATACAAAAGTAGG - Intronic
909709121 1:78624151-78624173 AAATACAAAAATACAAAAATTGG - Intronic
910215144 1:84836170-84836192 CTACAAAAAAATATAAAAATTGG + Intronic
910405328 1:86882959-86882981 CTACTAAAAAATACAAAAATTGG + Intronic
910702510 1:90091474-90091496 TTATACAAAGATATTAAAGTTGG - Intergenic
910869794 1:91822759-91822781 CTACACAAAAATACAAAAATTGG + Intronic
910979645 1:92946776-92946798 CTATAAAAAAATACAAAAATTGG + Intronic
911077160 1:93887634-93887656 CTCTACTAAAATACAAAAATTGG - Exonic
911497451 1:98649021-98649043 CTATACCAAAATACCACAATGGG + Intergenic
911515574 1:98864679-98864701 CTAAACAAAAAGAACAAAGTTGG - Intergenic
911542093 1:99169366-99169388 GTCTACTAAAATACAAAAATTGG - Intergenic
912438168 1:109676514-109676536 TAAAACAAAAATACAAAAATCGG - Intronic
913044210 1:115059762-115059784 CTTTAGAAAAATTCAAAAGGAGG + Intronic
913173242 1:116251110-116251132 CTAAAAAAAAATACCAAAATTGG + Intergenic
913674297 1:121126677-121126699 CTACCAAAAAATACAAAAATTGG + Intergenic
914026081 1:143913986-143914008 CTACCAAAAAATACAAAAATTGG + Intergenic
914303402 1:146395163-146395185 CTAAAAAAAAAAAAAAAAGTTGG - Intergenic
914664516 1:149821727-149821749 CTACCAAAAAATACAAAAATTGG + Intergenic
914671248 1:149872085-149872107 CTACCAAAAAATACAAAAATTGG - Intronic
914732181 1:150381255-150381277 CTCTACAAAAAAAAAAAAATAGG + Intronic
914776028 1:150736056-150736078 CTTTACTAAAATAAAAAATTGGG - Intronic
915243095 1:154537740-154537762 AGAAACAAAAATACAAAGGTTGG - Intronic
915450492 1:156001868-156001890 CTATGCACAAATACAATGGTGGG + Intronic
915454294 1:156029125-156029147 CTACAAAAAAATACAAACATTGG - Intergenic
915538007 1:156549158-156549180 CTATAAAAAAATACAAAAATTGG + Intronic
915562609 1:156696036-156696058 CTAAAAAAAAAAAAAAAAGTGGG - Intergenic
915758658 1:158288555-158288577 CGATAAAAAAATTAAAAAGTTGG - Intergenic
916289573 1:163149839-163149861 TTACATCAAAATACAAAAGTTGG + Intronic
917113981 1:171583136-171583158 CTACAAAAAAATAAAAAATTAGG - Intronic
917180148 1:172287173-172287195 CTAAACAAAAATAGAAAATGCGG - Intronic
917229419 1:172819894-172819916 CTACACAATAAAATAAAAGTCGG - Intergenic
917252983 1:173082368-173082390 CTATACAAAAAGAACAAAGCTGG + Intergenic
917339348 1:173958547-173958569 CAAAACAAAAAAAAAAAAGTTGG + Intronic
917354077 1:174107769-174107791 CTACTAAAAAATACAAAAATTGG - Intergenic
917635458 1:176931298-176931320 CTCTACTTAAATACAAAAATTGG + Intronic
918087265 1:181256335-181256357 CTACCAAAAAATACAAAAATTGG + Intergenic
918377797 1:183926587-183926609 CTATATAAAAATATATAAGAGGG + Exonic
918455002 1:184701842-184701864 CAATACAAGAAGACAAAATTAGG + Intronic
918726501 1:187932330-187932352 ATTCACAAAAATACAAATGTAGG + Intergenic
918834878 1:189449633-189449655 CCCTACAAAAATACAAAAATTGG - Intergenic
918976948 1:191501738-191501760 TTATATAAAAATCCTAAAGTAGG + Intergenic
919106727 1:193162769-193162791 CTCTCCAAAAATACCAAATTTGG - Intronic
919111012 1:193218465-193218487 CTAAGCAAAAAGACCAAAGTTGG + Intronic
919145718 1:193632198-193632220 CTATACCTGAATACAAAAGCAGG + Intergenic
919184048 1:194120972-194120994 TGCTACCAAAATACAAAAGTGGG - Intergenic
919517042 1:198538735-198538757 CTCTACAAAAATACAAAAATTGG + Intronic
919544478 1:198897279-198897301 CAATATAAAAATAGAAAATTGGG + Intergenic
919707836 1:200695700-200695722 CTACAAAAAAATACAAAAATTGG - Intergenic
920222374 1:204413002-204413024 CTATAAAAATATGCAAAAATTGG - Intergenic
920281371 1:204846195-204846217 CTATACAAAAAAAAAAAAAGAGG + Intronic
920411094 1:205761588-205761610 CTACAAAAAAATACAAAAACAGG - Intergenic
920411608 1:205765900-205765922 CTTTATAAAAATACAAAAATTGG + Intergenic
920797351 1:209152680-209152702 CTAAGAAAAAAAACAAAAGTGGG - Intergenic
920800289 1:209181311-209181333 CTAAACAAAAATAAAAAATATGG + Intergenic
921107453 1:211996858-211996880 CTACAAAAAAATACAAAAATTGG + Intronic
921114747 1:212078777-212078799 CTATAAAAAAATTAAAAGGTGGG - Intronic
921247332 1:213258268-213258290 CTCTACTAAAATACAAAAATGGG - Intronic
921540564 1:216409430-216409452 CTACACAAAAATAACAAAGGTGG + Intronic
921878610 1:220227915-220227937 CTAACTAAAAATACAAAAATTGG - Intronic
922243526 1:223773254-223773276 CTCTAAAAAAATAAAAAATTAGG + Intronic
922286262 1:224173294-224173316 CTATTCAAAAATATTAATGTGGG + Intergenic
922288912 1:224194232-224194254 CTCTAAAAAAAAAAAAAAGTTGG + Intergenic
922289575 1:224199222-224199244 AAATACAAAAATACAAAAATTGG + Intergenic
922303825 1:224326975-224326997 CTACAAAAAAATTAAAAAGTTGG + Intronic
922438603 1:225631406-225631428 CTATAAAAAAAAAAAAAAATTGG + Intronic
922737154 1:227993034-227993056 ATATACATATATACAAATGTTGG + Intergenic
922929171 1:229375437-229375459 CTCCAGAAAAATACAAAAATTGG + Intergenic
922982869 1:229842895-229842917 CTCCAAAAAAATACAAAAATTGG - Intergenic
923099944 1:230805387-230805409 TCATACAAAAAGACAAAAGTTGG + Intergenic
923807722 1:237277598-237277620 CTCTACAAAACTAAAAAATTAGG + Intronic
924053637 1:240103028-240103050 CTACAAAAAAATGCAAAAATCGG - Intronic
924197027 1:241618857-241618879 AAATAAATAAATACAAAAGTGGG - Intronic
924336264 1:242989437-242989459 CTACATAAAAATAATAAAGTGGG - Intergenic
1063172324 10:3520019-3520041 CTACTAAAAAATACAAAAATTGG - Intergenic
1063532495 10:6848123-6848145 ATATACTAGAATACAAAAATAGG - Intergenic
1063955171 10:11258850-11258872 GTCTACTAAAATACAAAAGTTGG - Intronic
1063992831 10:11584770-11584792 CTACAGAAAAATACAAAAATTGG + Intronic
1064049335 10:12046653-12046675 CTCTACTAAAATACAAAAATTGG + Intergenic
1064058357 10:12116863-12116885 CTACAAAAAAATACAAAAATTGG - Intronic
1064368678 10:14731095-14731117 CTAAACCAAAATCCAAAATTTGG + Intronic
1064515220 10:16140143-16140165 CTATACAAAAAGAACAAAGCTGG - Intergenic
1064742370 10:18446896-18446918 CTCTAAAAAAATAAAAAATTAGG + Intronic
1064840787 10:19589237-19589259 GTATACATAAATACCAATGTTGG - Intronic
1065038928 10:21671182-21671204 CTCTACTAAAATACAAAAACTGG - Intronic
1065041310 10:21699681-21699703 CTGTAAAAAAAAAAAAAAGTGGG + Intronic
1065232040 10:23608269-23608291 CTATCAAAAAATAAAAAATTAGG + Intergenic
1065582047 10:27181772-27181794 CTACTAAAAAATACAAAAATTGG + Intronic
1065940161 10:30557031-30557053 CTCTAAAAAAATAAAAAATTAGG + Intergenic
1066129453 10:32378382-32378404 CTAAAGAAAAATACAAAGATTGG + Intronic
1067480700 10:46595613-46595635 CTACTAAAAAATACAAAATTAGG - Intergenic
1067606412 10:47667716-47667738 CAAAACAAAAAAACAAAAATTGG - Intergenic
1067614039 10:47746188-47746210 CTACTAAAAAATACAAAATTAGG + Intergenic
1067664504 10:48264913-48264935 CTATACAAAAAGAACAAAGCAGG + Intronic
1068522298 10:58091174-58091196 CTACCAAAAAATACAAAATTTGG + Intergenic
1068594047 10:58883286-58883308 CAGTACATAATTACAAAAGTTGG - Intergenic
1068814932 10:61298611-61298633 CAAAACAAAAATAGACAAGTGGG - Intergenic
1069022036 10:63500255-63500277 CTACAAAAAAATACAAAAATTGG + Intergenic
1069046139 10:63745484-63745506 CTAAACAAAAAGAATAAAGTTGG + Intergenic
1069142341 10:64841550-64841572 CTTTACAGAAATACAGAAGGGGG - Intergenic
1069181824 10:65370534-65370556 CTCTACTAAACTACAAAATTGGG - Intergenic
1069187421 10:65442461-65442483 CTAAGCAAAAATAGAAAAGGTGG + Intergenic
1069481601 10:68787667-68787689 CTCTCCAAAAATACAAAAATTGG + Intronic
1069538804 10:69277663-69277685 AGCTACAAAAATACAAAAGATGG - Intronic
1069974308 10:72199895-72199917 CTACAAAAAAATACAAAAATTGG - Intronic
1070258932 10:74834684-74834706 CTCTACAAAAATAAAAAATTAGG - Intronic
1070521250 10:77255611-77255633 AAATAAAAAAATATAAAAGTGGG + Intronic
1071072357 10:81709589-81709611 CTATATAAAAATAGAAAATTAGG + Intergenic
1071084716 10:81856644-81856666 CTATAAAATAACACAAAAGAAGG - Intergenic
1071357707 10:84814542-84814564 CAAAACAAAAATAAACAAGTGGG - Intergenic
1071621973 10:87129069-87129091 CAAAACAAAAAAACAAAAATTGG - Intronic
1071629449 10:87206162-87206184 CTACTAAAAAATACAAAATTAGG + Intergenic
1071652837 10:87411547-87411569 CTCTAATAAAATACAAAAATTGG - Intergenic
1071841160 10:89472981-89473003 CTACAAAAAAATACAAAAATTGG - Intronic
1071940339 10:90584718-90584740 GTTTACAAAAATTTAAAAGTTGG + Intergenic
1072034205 10:91549655-91549677 CTACAAAAAAATACAAAAATTGG + Intergenic
1072934750 10:99701451-99701473 CTACAAAAAAATACAAAAATTGG - Intronic
1073228883 10:101949881-101949903 CTATACTAACAGACAATAGTAGG + Intronic
1073888022 10:108063874-108063896 CAATGCAAAAATTCAAAAGTGGG - Intergenic
1074350853 10:112735297-112735319 CAAAACAAAAATACAGATGTAGG + Intronic
1074371061 10:112901154-112901176 CTCTACAAAAATACAAAAATTGG - Intergenic
1074477125 10:113783721-113783743 TAATACAAAAATACAAGCGTGGG + Intergenic
1074513131 10:114137734-114137756 CTCTACTAAAATAAAAAAATTGG + Intronic
1074515958 10:114169894-114169916 CTACACATAAATAAATAAGTAGG - Intronic
1075029230 10:119010445-119010467 TAACACAAAAATAGAAAAGTGGG - Intergenic
1075367114 10:121901620-121901642 CTCTACTAAAATATAAAAATTGG - Intronic
1075514087 10:123095481-123095503 CTCTACAAATATAGAAAAGGAGG + Intergenic
1075635618 10:124028423-124028445 ATGAACAAAAATACAAAAGGAGG - Intronic
1075905461 10:126077804-126077826 CTTTAAAAAAATAAAAAGGTGGG - Intronic
1075987527 10:126800414-126800436 CCTTACAAAAATGCAATAGTTGG - Intergenic
1076095525 10:127732465-127732487 CTACTTAAAAATACAAAAGTTGG + Intergenic
1076106039 10:127824452-127824474 CTACAAAAAAATACAAAAATTGG - Intergenic
1077792627 11:5457974-5457996 CAAAACAAAAATATACAAGTAGG - Intronic
1077986613 11:7358046-7358068 CTCTAAAAAAGTATAAAAGTGGG + Intronic
1078169236 11:8916118-8916140 CTATTAAAAAATACAAAAATGGG - Intronic
1078375452 11:10789726-10789748 CTACTAAAAAATACAAAAATTGG + Intergenic
1078615145 11:12857918-12857940 TTACAAAAAAATACAAAAGTTGG + Intronic
1079043648 11:17080886-17080908 CTCTACTAAAATACAAAAATTGG - Intronic
1079072600 11:17360900-17360922 CTCTACAAAAATACAAAAATTGG - Intronic
1079221498 11:18565661-18565683 CTTATCAAAAATACAAAAATTGG + Intronic
1079558873 11:21796031-21796053 AAATACAAAAATAGACAAGTGGG - Intergenic
1079773395 11:24492963-24492985 CTTCACAAATACACAAAAGTTGG + Intergenic
1079817645 11:25081890-25081912 CTATAGAGAAATACAATTGTTGG - Intronic
1080179220 11:29403157-29403179 CAAGGCAAAAATACAAATGTTGG + Intergenic
1080523395 11:33088444-33088466 CTCTACTAAAATACAAAAATTGG - Intronic
1080544749 11:33305164-33305186 CTACCAAAAAATACAAAAGTTGG - Intronic
1080668209 11:34354457-34354479 CTATTTAAAAAAACAAAAGGTGG + Intronic
1080937462 11:36879617-36879639 CTCTACTAAAATACAAAATTTGG - Intergenic
1081110041 11:39123950-39123972 CAATACAAAAATTTAAAAGATGG + Intergenic
1082668166 11:56001325-56001347 AAAAACAAAAATAGAAAAGTAGG - Intergenic
1082682261 11:56189552-56189574 TTATGGAAAAATACTAAAGTTGG - Intergenic
1082943746 11:58735900-58735922 CCATGCAAAAATACATGAGTAGG + Intergenic
1083116732 11:60467440-60467462 CTCTACAAAAATACAAAAATTGG - Intronic
1083578030 11:63806486-63806508 CTCTATAAAAATACAAAATGGGG + Intergenic
1083690975 11:64408745-64408767 CACCAAAAAAATACAAAAGTTGG + Intergenic
1084002763 11:66306437-66306459 CTATAAAAGACTGCAAAAGTGGG + Intergenic
1084061995 11:66681972-66681994 TTATACAAAAGTTCAAAAGCAGG - Intergenic
1084128276 11:67115491-67115513 CTAAACTAAAATAGAGAAGTTGG - Intergenic
1084194257 11:67515221-67515243 CTCTAAAAAAACAAAAAAGTGGG - Intergenic
1084340918 11:68500281-68500303 ATATACAAAAAAAAAAAGGTAGG - Intronic
1084401741 11:68947995-68948017 CTAAACAAAAATAAAATGGTTGG - Intergenic
1085089999 11:73703862-73703884 TCATATAAAAATACAAAAATTGG + Intronic
1085669276 11:78447182-78447204 CTATTTAAAAATATAAATGTAGG - Intronic
1085753426 11:79183985-79184007 ATATTCAAAAATAGAATAGTTGG - Intronic
1085911724 11:80834787-80834809 CTACAAAAAAATACAAAAATTGG - Intergenic
1086029985 11:82343062-82343084 CAAAACAAAAATAGACAAGTGGG + Intergenic
1086960413 11:92974900-92974922 CTACTAAAAAATACAAAATTAGG - Intronic
1087187120 11:95211602-95211624 CCAAAAAAAAATACAAAAATTGG + Intronic
1087244554 11:95818823-95818845 CTAGAAAAAAATGCAAGAGTTGG + Exonic
1087734116 11:101812306-101812328 GTATACAAACATACACATGTAGG - Intronic
1087742064 11:101899264-101899286 CTCTATAAAAACACAAAAGACGG - Intronic
1087760583 11:102100606-102100628 CTACAAAAAAATATAAAAATTGG - Intergenic
1088310441 11:108454596-108454618 ATAAACAAAAATGTAAAAGTAGG - Intronic
1088338272 11:108733105-108733127 CTAAAAAAAAAAAAAAAAGTAGG - Intronic
1088650343 11:111952520-111952542 CTACAAAAAAATCCAAAAATTGG + Intronic
1088791986 11:113234253-113234275 CTTTAAAAAAAAAAAAAAGTCGG - Intronic
1089277723 11:117350071-117350093 CTACTAAAAAATACAAAAATTGG - Intronic
1089474254 11:118745456-118745478 CTCTACAAAAATGCAAAAATTGG - Intergenic
1089478452 11:118785504-118785526 CTTTAAAAAAAAAAAAAAGTTGG - Intronic
1090015864 11:123086076-123086098 CTCTACTAAAATAAAAAATTAGG - Intronic
1090026480 11:123171608-123171630 CTCTACTAAAAAACAAAAATTGG - Intronic
1090175543 11:124645890-124645912 CTATACAAATATTCAAAAGAAGG + Intronic
1090215886 11:124964083-124964105 CTAAACAAAAAGAACAAAGTTGG - Intronic
1090864282 11:130683434-130683456 CTAAACAAAAATAACAAAGTTGG - Intronic
1091258169 11:134209888-134209910 CTACAAAAAAATGCAAAAATTGG + Intronic
1091267879 11:134284740-134284762 CGAAACAAAAAAACAAAACTCGG + Intronic
1091768842 12:3138658-3138680 CTCTACAAAAATACAAAAAAAGG - Intronic
1092251296 12:6899121-6899143 CTCTACTAAAATACAAAAATTGG - Intronic
1092313820 12:7388576-7388598 CTACAAAAAACTACAAAAATTGG + Intronic
1092455668 12:8640479-8640501 ATATACAAAAAAAAAAAAATCGG + Intronic
1092576449 12:9788593-9788615 ATATAGAAAACAACAAAAGTCGG - Intergenic
1092782474 12:11999800-11999822 CTACAAAAAAATACAAAAATTGG - Intergenic
1092935559 12:13360337-13360359 CTATACAAAAGCACAGAAGAGGG - Intergenic
1092973654 12:13723295-13723317 GTATACTAAAAAACAAAAGGTGG - Intronic
1093738400 12:22651849-22651871 CTACTAAAAAATACAAAACTCGG - Intronic
1093817773 12:23570608-23570630 CTCTAAAAAAATACAAAAATTGG + Intronic
1093848567 12:24006965-24006987 GTCTACAAAAACACAAAAATTGG + Intergenic
1094165850 12:27442784-27442806 CTACAAAAAAATCCAAAAATTGG - Intergenic
1094169403 12:27476614-27476636 CTATAAAAAAAGACAAAGGAGGG - Intronic
1094225092 12:28036222-28036244 CTCTACTAAAATACAAAAATTGG + Intergenic
1094345360 12:29462190-29462212 CTTTACAAAAATGCCAAATTGGG - Intronic
1094371135 12:29738895-29738917 CTCTACAAAACTATAAAAATGGG + Intronic
1094441497 12:30482426-30482448 CTATACAAAAATACTTAAATTGG - Intergenic
1094551448 12:31455719-31455741 CTATTAAAAACAACAAAAGTGGG + Intronic
1094558385 12:31525825-31525847 CTACAGAAAAATATAAAAATTGG + Intronic
1095337376 12:41045040-41045062 TCATAGAAAAATACAAAATTAGG - Intronic
1095381107 12:41593580-41593602 TTATAGAAAAATATTAAAGTTGG - Intergenic
1095436849 12:42198417-42198439 CTACAAAAAAATACAAAAATTGG + Intronic
1095604965 12:44055804-44055826 ATATACAAAGTTAAAAAAGTAGG - Intronic
1096056787 12:48659455-48659477 CTATACAAAAAATAAAAAATTGG + Intronic
1096129136 12:49143574-49143596 CTATCAAAAAATACAAAAATTGG - Intergenic
1096152800 12:49325217-49325239 CACTAAAAAAATACAAAAATTGG - Intronic
1096209936 12:49757031-49757053 CTCTACTAAAATACAAAATTAGG - Intronic
1096213694 12:49786613-49786635 CTACAAAAAAATAGAAAATTAGG - Intergenic
1096306649 12:50483767-50483789 CTACATAAAAATAAAAAAATAGG - Intergenic
1096439255 12:51625622-51625644 CTGTCCAAAAAAACAAAAGAGGG - Intronic
1096585965 12:52619893-52619915 CTATACAGAAATAGAAAAGAAGG - Intergenic
1096701309 12:53384817-53384839 TTCGACAAAAATACAAAAATTGG + Intronic
1096712814 12:53470044-53470066 TTCTACAAAAAAACAAAAGCAGG - Intronic
1096917759 12:55051586-55051608 AAAAACAAAAAAACAAAAGTGGG + Intergenic
1096962830 12:55597913-55597935 CTCTACAAAAAAAAAATAGTGGG + Intergenic
1097026368 12:56058772-56058794 CTCCACAAAAATAAAAAACTTGG + Intergenic
1097050366 12:56219493-56219515 CTCTACTAAAATATAAAAATTGG - Intronic
1097601995 12:61704447-61704469 CTAGAGAGAAATTCAAAAGTGGG - Intergenic
1097842475 12:64335248-64335270 CTCTACTAAAACACAAAAATTGG + Intronic
1098257815 12:68635619-68635641 CTCTACCAAAATACAAAAATTGG - Intronic
1098263309 12:68693375-68693397 CTATAAAGAAATAAAAAATTAGG - Intronic
1098320974 12:69242940-69242962 CTCTATCAAAATACAAAAATTGG + Intronic
1098363550 12:69678894-69678916 CTTTACAAAAAAATAAAAATCGG + Intronic
1098408453 12:70152414-70152436 CAAAACAAAAATAGAAAAGTGGG + Intergenic
1098685225 12:73411150-73411172 CTAAGCAAAAATAACAAAGTTGG - Intergenic
1098801632 12:74967172-74967194 CAGTAAAATAATACAAAAGTTGG - Intergenic
1098876251 12:75869074-75869096 GTATATAAAAATATAAAGGTGGG - Intergenic
1099374112 12:81875633-81875655 TTATACAAAACTTTAAAAGTTGG - Intergenic
1099483275 12:83195514-83195536 CTATATAAAAGTATAAAAATGGG - Intergenic
1099501880 12:83423346-83423368 CTATAAAAAAGTACCAAACTGGG - Intergenic
1099623736 12:85038913-85038935 ATTTACAAATATACAACAGTAGG - Intronic
1099685902 12:85888759-85888781 ATGTACAATAAAACAAAAGTAGG - Intergenic
1099857722 12:88188679-88188701 CTAGGCAAAAATGCAAAAGCAGG - Intronic
1100265580 12:92972897-92972919 CTCTACAAAAATACAAAAACTGG + Intergenic
1100486828 12:95037579-95037601 TTATCTAAAAATATAAAAGTTGG - Intronic
1100847399 12:98674154-98674176 CTACAAAAAAATAAAAAATTAGG - Intronic
1100986331 12:100204663-100204685 CTCTACAAAAATAAAAAATAAGG - Intronic
1101099381 12:101376946-101376968 CTCTACAGAAATACAAAAATTGG - Intronic
1101118597 12:101555779-101555801 CTATAAAAAAATTAAAAACTTGG - Intergenic
1101353989 12:103959544-103959566 CTCTACTAAAATACAAAAATTGG + Intronic
1102339893 12:112113323-112113345 CTACTAAAAAATACAAAAATTGG + Intergenic
1102376270 12:112423914-112423936 CTACAAAAAAATAGAAAAATTGG - Intronic
1102757123 12:115350788-115350810 CTACCAAAAAATACAAAAATTGG + Intergenic
1103474977 12:121211366-121211388 CTACTAAAAAATACAAAAATTGG - Intronic
1103756818 12:123214372-123214394 CTACAAAAAAATACAAAAGCTGG + Intronic
1103804898 12:123564732-123564754 CTCTAATAAAATACAAAATTAGG - Intergenic
1103828375 12:123758946-123758968 CTTTAAAAAAATATACAAGTGGG - Exonic
1103882666 12:124178317-124178339 CTCTACAAAAATACATTAGCTGG - Intronic
1104524066 12:129501668-129501690 CTACAAAAAATTACAAAAGTTGG - Intronic
1104984806 12:132590669-132590691 CTATTAAAAAATACAAAATTAGG - Intergenic
1105208631 13:18244006-18244028 CTAAAAAAGAATACAAAAATTGG + Intergenic
1105464170 13:20621829-20621851 CTATACAATACTACAATGGTGGG - Intronic
1105887948 13:24658649-24658671 CTACAAAAAAATACAAAAATTGG + Intergenic
1105946426 13:25194102-25194124 CTACAAAAACATACAAAAATTGG + Intergenic
1105946477 13:25194748-25194770 CTATGAAAAAATAAAAAAATGGG + Intergenic
1106056563 13:26243279-26243301 CAAAACCAACATACAAAAGTCGG - Intergenic
1106094110 13:26627687-26627709 CTATAAACACATACAAATGTTGG + Intronic
1106202021 13:27546318-27546340 CTTTAAAAAAATAGCAAAGTTGG + Exonic
1106324519 13:28675303-28675325 CTCTACTAAAATACAAAATTAGG - Intronic
1106430476 13:29675987-29676009 CTAAAAAAAAATACAAAAATTGG + Intergenic
1106535119 13:30633604-30633626 CTACTAAAAAATACAAAAATTGG + Intronic
1106600650 13:31183661-31183683 CTCCAAAAAAAAACAAAAGTTGG + Intergenic
1107147825 13:37078355-37078377 CTCTACTAAAATACAAAAATTGG - Intergenic
1107219300 13:37962303-37962325 CAAAACAAAAATAGACAAGTGGG - Intergenic
1107744571 13:43490812-43490834 CTATACCAAAATACAATAGATGG - Intronic
1107802414 13:44121180-44121202 ATATACAAAAACACAACTGTTGG + Intergenic
1107874962 13:44782367-44782389 CTCTACAAAAATACAAAAATTGG - Intergenic
1108201815 13:48051532-48051554 CTATTCAAAAAGACAAAAATGGG - Intergenic
1108371942 13:49778770-49778792 CTACACAAAATTTAAAAAGTAGG - Intronic
1108730912 13:53234696-53234718 CATTGCAAAAATACAAAAGATGG - Intergenic
1108832709 13:54499438-54499460 ATATAAAAGAATACAAAAATGGG + Intergenic
1109152303 13:58860064-58860086 ACATCCAAAAATACAAAAGGAGG - Intergenic
1109176443 13:59163085-59163107 CCATAAAAAAATCCATAAGTTGG - Intergenic
1109191424 13:59328305-59328327 CTACAGAAAAATACAAAAATTGG + Intergenic
1109444233 13:62412295-62412317 CTAATCAAAAATTCAAAAGTGGG + Intergenic
1109507620 13:63326718-63326740 CTAAAGAAAAATTAAAAAGTTGG - Intergenic
1109697897 13:65984994-65985016 GTATACAAAAATTCAAAACATGG - Intergenic
1109918306 13:69021232-69021254 CTACTAAAAAATACAAAATTAGG + Intergenic
1109955031 13:69554533-69554555 CTATAAAAATATAAAACAGTGGG - Intergenic
1110628813 13:77682318-77682340 ATATAAAAAAATACAAAAGTTGG + Intergenic
1110989980 13:82028199-82028221 CAAAACAAAAATACACGAGTAGG + Intergenic
1111276656 13:85957204-85957226 CTAAGCAAAAAGAAAAAAGTTGG - Intergenic
1111278036 13:85978010-85978032 AAATACAAAAATAAAAAAGAAGG + Intergenic
1111294905 13:86265690-86265712 CTACAAAAAAATACAAAAATGGG - Intergenic
1111295271 13:86269203-86269225 CTACCAAAAAATACAAAAATTGG - Intergenic
1111437739 13:88233424-88233446 ATAAACAAACATAAAAAAGTCGG - Intergenic
1111455658 13:88480533-88480555 CTATAAAAGAATAAAAAAATGGG - Intergenic
1111520562 13:89397281-89397303 CTAAGCAAAAATAGACAAGTGGG - Intergenic
1111580466 13:90216028-90216050 CTAGAAAAAGATACAAAATTGGG + Intergenic
1111726776 13:92020844-92020866 AGAAACAAAAATACACAAGTAGG - Intronic
1112049740 13:95633516-95633538 CCACAAAAAAATACAAAATTAGG + Intronic
1112510108 13:100001260-100001282 CTCTACTAAAATACAAAAATAGG - Intergenic
1112831805 13:103461961-103461983 TTATACAAAAAAACAAAAACAGG - Intergenic
1113074783 13:106457087-106457109 CCATAAAAAAATACAACAGCTGG - Intergenic
1113161018 13:107381360-107381382 CTACAGAAAAATAAAATAGTTGG - Intronic
1113379795 13:109793326-109793348 TTACAGAATAATACAAAAGTGGG + Intergenic
1113429021 13:110233182-110233204 CTATCAAAAAAGACAAAAGTAGG + Intronic
1113713527 13:112487741-112487763 TTCAACAAAAATGCAAAAGTAGG + Intronic
1114148004 14:20000571-20000593 ATATACAAAAATCCAAAAAATGG - Intergenic
1114157648 14:20123526-20123548 CAATACAAAAATACAAAAGTGGG + Intergenic
1114574020 14:23696065-23696087 CTATATAAAGTTACAAAGGTTGG + Intergenic
1114600883 14:23954496-23954518 CAAAACTAAAATACAAATGTAGG + Intronic
1114610563 14:24037208-24037230 CAAAACTAAAATACAAATGTAGG + Intergenic
1115197433 14:30816645-30816667 CTCTATTAAAATACAAAAATTGG - Intergenic
1115234604 14:31196586-31196608 CTACTAAAAAATACAAAAATTGG + Intronic
1115259883 14:31441035-31441057 CTACAAAAAAATACAAAATTAGG + Intronic
1115525621 14:34278052-34278074 ATATATAAAAATACAAAAATGGG - Intronic
1115581869 14:34767983-34768005 CTATGCAAAAATAGAAAAATAGG - Intronic
1115671062 14:35612203-35612225 CTCTACAAAAATTTAAAAATTGG + Intronic
1115695548 14:35894200-35894222 GGATACAAAAACACAAAAATTGG - Intronic
1115984393 14:39088866-39088888 CTACTAAAAAATACAAAAATTGG + Intronic
1116204746 14:41849441-41849463 TTAAAAAAAAAAACAAAAGTGGG + Intronic
1116209365 14:41913470-41913492 CCATAAAAAAATTAAAAAGTTGG - Intergenic
1116275982 14:42832087-42832109 GTATACATAAATATAAAATTTGG - Intergenic
1116304708 14:43237180-43237202 CTCTACAAAAATACAAAACTTGG + Intergenic
1116327249 14:43546127-43546149 CTCTACTAAAATACAAAAGATGG + Intergenic
1116461827 14:45185799-45185821 TTACAGAAAAATAAAAAAGTTGG + Intronic
1116544008 14:46140049-46140071 CTATAGAAAAATGTAAAATTTGG - Intergenic
1116729472 14:48603658-48603680 CTCTATAAAAATACAAAAATTGG + Intergenic
1116798451 14:49416425-49416447 TTCTACATAAATAAAAAAGTCGG + Intergenic
1116915615 14:50522773-50522795 CTATCAAAAAATAAGAAAGTAGG + Intronic
1116946601 14:50841185-50841207 TTGAACAAAAATACAAAAGATGG + Intergenic
1116991888 14:51285746-51285768 CTATAGAAAAACAAAAAAGCAGG - Intergenic
1117317325 14:54585048-54585070 TTACACAAATATACAAAATTAGG + Intronic
1117585601 14:57199863-57199885 CTCTACAAAAATACAAATGGCGG - Intergenic
1117671896 14:58116508-58116530 CTACAAAAAAATACAAAAGTTGG + Intronic
1117914835 14:60666687-60666709 CTCTACAAAAATAAAAAAATTGG - Intergenic
1118106266 14:62663516-62663538 TTATACAAAAATTCAAAATAAGG - Intergenic
1118160902 14:63289234-63289256 CTCTTGAAAAATACAAAAATGGG + Intronic
1118696424 14:68390649-68390671 CTATGCAGAGATACAATAGTAGG + Intronic
1119028737 14:71175024-71175046 CTCTAAAAAAATACAAAAATTGG - Intergenic
1119069775 14:71570959-71570981 CTCTACTAAAATACAAAAATTGG - Intronic
1119075902 14:71638894-71638916 CTAAACAAACAAACAAAACTTGG + Intronic
1119136713 14:72228076-72228098 GAATATGAAAATACAAAAGTAGG + Intronic
1119255867 14:73195814-73195836 TTATACAAAAATATAACACTGGG - Intronic
1119461819 14:74811315-74811337 CTACAAAAAATAACAAAAGTTGG + Intronic
1119563049 14:75606189-75606211 CTACAAAAAAATACAAAAATTGG - Intronic
1119917936 14:78419510-78419532 CTAAACCAAAATTTAAAAGTTGG - Intronic
1120291276 14:82574265-82574287 CTATGAAAAAATACACAAGTTGG - Intergenic
1120368610 14:83603675-83603697 CTAAACAAAAATAATAAAGCTGG - Intergenic
1120576106 14:86182957-86182979 ATAAACAAAAATAGACAAGTGGG - Intergenic
1121350153 14:93167037-93167059 CTATACAAAAATAAAAATTAGGG - Intergenic
1121475447 14:94197042-94197064 CTATACAAAACAACAAAAAAGGG - Intronic
1121481385 14:94278321-94278343 TTATACAAAATTAAAAATGTAGG + Intronic
1121500671 14:94434497-94434519 CTCTACTAAAATACAAAAGGTGG - Intergenic
1122000176 14:98642446-98642468 CAATACAAGAAAACAGAAGTTGG + Intergenic
1122218084 14:100217364-100217386 CTCTACAAAAATACAAAAATTGG - Intergenic
1122441480 14:101735048-101735070 AAATACAAAAATACAAAAATTGG - Intergenic
1124128075 15:26956837-26956859 CTCTACCAAAATACAAAAACTGG - Intergenic
1124665913 15:31592579-31592601 CTTTAAAAAAATATATAAGTAGG + Intronic
1124797219 15:32793443-32793465 CTACTAAAAAATACAAAACTTGG - Intronic
1124889747 15:33721804-33721826 CAATACATATATTCAAAAGTGGG - Intronic
1125368029 15:38940087-38940109 GTAAACAAAAATAAAAAAATAGG + Intergenic
1125576267 15:40757634-40757656 CTACTAAAAAATACAAAAATTGG + Intergenic
1125588002 15:40835318-40835340 CTCTACAAAAATACAAAAATAGG - Intergenic
1125688247 15:41576491-41576513 CTACTAAAAAATACAAAAATTGG - Intronic
1125839983 15:42791182-42791204 CTACTGAAAAATACAAAAATTGG - Intronic
1125841572 15:42806097-42806119 CTACAAAAAAATACAAAAATTGG + Intronic
1125845774 15:42852068-42852090 CTAAAAAAAAAAAAAAAAGTTGG - Intronic
1125864427 15:43031866-43031888 ATATACATATATACAAAAATTGG + Intronic
1125876781 15:43155061-43155083 TTACAAAAAAATACAAAAATTGG + Intronic
1125888186 15:43244901-43244923 CTACAAAAAAATAAAAAAATTGG + Intronic
1125984569 15:44037627-44037649 CTATAAAAAAAAAAAAAAGCTGG - Intronic
1126010083 15:44294411-44294433 CTACTTAAAAATACAAAAATTGG + Intronic
1126162409 15:45625869-45625891 CTCTACTAAAATACAAAAATTGG - Intronic
1126222734 15:46232997-46233019 CAATAAAAAAATGCACAAGTCGG - Intergenic
1126239251 15:46422427-46422449 CTATAAAAAAAGAGCAAAGTGGG + Intergenic
1126240122 15:46432399-46432421 CGATACAAAAATGCAAAAGACGG - Intergenic
1126585514 15:50282030-50282052 CTACAAAAAAATACAAAAATTGG + Intronic
1126654917 15:50966701-50966723 CTCTACTAAAATACAAAAATGGG - Intronic
1126995278 15:54435896-54435918 CAAAACAAAAATCAAAAAGTGGG + Intronic
1127075172 15:55318536-55318558 CTACAAAAAAACACAAAAATTGG + Intronic
1127085826 15:55423786-55423808 CTATTAAAAAATACAAAAATAGG + Intronic
1127316758 15:57802959-57802981 CAATACCAATATACAAAAATAGG + Intergenic
1127402550 15:58604193-58604215 CTGTGCTAAAATACAAAAATTGG + Intronic
1127791586 15:62403408-62403430 CAAAACAAAAAAACAAAAATTGG - Intronic
1128009168 15:64275205-64275227 CTCTACTAAAATACAAAAGTTGG - Intronic
1128346511 15:66856260-66856282 CAAAAAAAAAATGCAAAAGTAGG + Intergenic
1128571744 15:68738615-68738637 CTCTATAAAAAAATAAAAGTAGG - Intergenic
1129260319 15:74363398-74363420 CTCTACTAAAATACAAAAATTGG - Intronic
1129349869 15:74949500-74949522 CTCTTCAAAAATACAAAAATTGG - Intergenic
1129439707 15:75571726-75571748 CTCTACTAAAATATAAAAATTGG + Intronic
1129449790 15:75644771-75644793 CTATACAAAAATACAAAAGTTGG + Intronic
1129502351 15:76051303-76051325 CTATAAAAAAATAAATAAATAGG - Intronic
1129558910 15:76544765-76544787 CTATACCAAAAAACAAAAATTGG + Intronic
1129746139 15:78022847-78022869 CTATTTAAAAAAAAAAAAGTTGG - Intronic
1129981537 15:79876310-79876332 CTGTTCAAAAAAACTAAAGTAGG + Intronic
1130410627 15:83645324-83645346 AAATACAAAAATACAAAAATTGG - Intergenic
1130422988 15:83766926-83766948 CTCTACGAAAATACAAAAACAGG + Intronic
1130427934 15:83820190-83820212 CTGTATAAAAATACAAAACTGGG - Intronic
1130505775 15:84539996-84540018 CACTAAAAAAATACAAAAGTTGG + Intergenic
1130534310 15:84772382-84772404 CTCTACAAAAATAAAAAAACTGG + Intronic
1130631785 15:85576708-85576730 CAATTCTAAAACACAAAAGTGGG - Intronic
1130782403 15:87056002-87056024 CTAAACAAAAATTGACAAGTAGG + Intergenic
1131217202 15:90548053-90548075 CTCTACAAAAATACAAAAACTGG - Intronic
1131436574 15:92427507-92427529 CTTTATAAAAATCCAAAATTTGG - Intronic
1131452471 15:92555832-92555854 TAACACAAAAATACAAAGGTAGG + Intergenic
1131497980 15:92931538-92931560 GTCTACAAAAATACAAAATCAGG - Intronic
1132104501 15:99053295-99053317 CTAAACAAACATAGAAAAGGCGG - Intergenic
1132540661 16:507409-507431 CTATAAAAAAATTAAAAACTAGG - Intronic
1132938582 16:2495479-2495501 CTACAAAAAAATAAAAAATTAGG + Intronic
1133193433 16:4151447-4151469 CTCTACAAAAATACAAATCTCGG + Intergenic
1133265471 16:4580822-4580844 TTCTAGAAAAATACAAAATTAGG + Intronic
1133756353 16:8765168-8765190 CTAAAAAAAAATTCAAAAATTGG + Intronic
1133882661 16:9797699-9797721 CTGTACAAAATTACATAACTAGG - Intronic
1134114457 16:11537704-11537726 CTCTACAAAAATACAAAAATTGG - Intergenic
1134206027 16:12238488-12238510 CTCTACAAAAATACAAAAATTGG - Intronic
1134867414 16:17620615-17620637 CTATATCAAAAAACAAAAGCTGG - Intergenic
1135062126 16:19279941-19279963 CTACTAAAAAATACAAAAATTGG - Intergenic
1135123478 16:19786531-19786553 CTACCAAAAAATACAAAAATTGG + Intronic
1135123844 16:19790050-19790072 CTACAAAAAAATACAAAAATGGG + Intronic
1135196208 16:20397299-20397321 AAAAAGAAAAATACAAAAGTTGG - Intronic
1135252406 16:20912098-20912120 TTGTAAAAAAATACAAAAATTGG - Intronic
1135409075 16:22219462-22219484 CTCTACAAAAATAAAAAATTAGG + Intronic
1135436020 16:22427278-22427300 CTACTAAAAAATACAAAAATTGG - Intronic
1135530934 16:23253955-23253977 CTACAAAAAAATACAAAAATTGG + Intergenic
1135536013 16:23295041-23295063 CTATACAGAAAAACAAATGCAGG - Intronic
1135737634 16:24945155-24945177 CTCTACAAAAATACAAAAATTGG + Intronic
1135791212 16:25398000-25398022 ATATACCAAAGTACAAAAGATGG + Intergenic
1135844148 16:25902931-25902953 ATACAAAAAAATACAAAAATTGG + Intronic
1135914384 16:26591950-26591972 CTCTGCAAAATTTCAAAAGTGGG + Intergenic
1136233505 16:28901465-28901487 CTACCAAAAAATACAAAAATTGG + Intronic
1136291595 16:29275793-29275815 CTATAAAAAAATTTAAAAATTGG - Intergenic
1136347812 16:29687579-29687601 ATGTACTAAAATACAAAAATTGG + Intronic
1136354784 16:29737288-29737310 GTAAAAAAAAATACAAAATTAGG + Intergenic
1136486791 16:30578036-30578058 CATTATAAAAATACAAAAATTGG + Intronic
1136715175 16:32274512-32274534 CAAAACAAAAATAGACAAGTAGG + Intergenic
1136752740 16:32655219-32655241 CAAAACAAAAATAGACAAGTAGG - Intergenic
1136821850 16:33325226-33325248 CAAAACAAAAATAGACAAGTAGG + Intergenic
1136828413 16:33381765-33381787 CAAAACAAAAATAGACAAGTAGG + Intergenic
1136833479 16:33480537-33480559 CAAAACAAAAATAGACAAGTAGG + Intergenic
1136996245 16:35191505-35191527 CTATAAAACAATAAAAAATTAGG - Intergenic
1137283642 16:46999117-46999139 GTATAAAAAATTATAAAAGTAGG + Intergenic
1137331889 16:47505629-47505651 CTCTGCTAAAATACAGAAGTTGG - Intronic
1138231815 16:55343186-55343208 CTATACAGAAATACAAATAGAGG - Intergenic
1138488930 16:57364802-57364824 CCATAAAAAAAAAAAAAAGTTGG - Exonic
1138492811 16:57386337-57386359 CTAAAAAAAAAAAAAAAAGTAGG + Intergenic
1138579962 16:57934280-57934302 CTACAAAAAAATTCAAAAATCGG + Intronic
1138582393 16:57950144-57950166 CTGTACAAAAAGAAAAAAGGAGG + Intronic
1138788084 16:59869785-59869807 CTCTACAAAAATTTAAAAATTGG + Intergenic
1139202706 16:64995292-64995314 CTAAGCAAAAAGAAAAAAGTTGG + Intronic
1139542261 16:67627187-67627209 CTCTACAAAAAGAAAAAATTAGG + Intronic
1139832499 16:69811297-69811319 TTATTTAAAAATACAAAAATTGG - Intronic
1140075598 16:71695869-71695891 CTATATAAAAATAATCAAGTTGG + Intronic
1140334351 16:74090575-74090597 CCAAAGAAAAATACAAAACTAGG - Intergenic
1140350987 16:74261717-74261739 CTTTACAAAAATACAAAAATTGG + Intergenic
1140437770 16:74962230-74962252 CTAAACAAAAATAACAAAGCTGG - Intronic
1140439205 16:74973867-74973889 CTCTACTAAAACACAAAAATTGG + Intronic
1140497396 16:75401126-75401148 CTATTAAGAAATACAAAAATTGG + Intronic
1140610920 16:76598084-76598106 CAAAACAAAAATACACAAGTGGG - Intronic
1140756448 16:78071776-78071798 CAAGACAAAAAAACAAAAGCTGG + Intergenic
1140774577 16:78238463-78238485 CTCTACAAAGACACAAAAATTGG - Intronic
1141070501 16:80950190-80950212 CTATACAGATATACAAAAATAGG - Intergenic
1141217865 16:82042167-82042189 CTACTAAAAAATACAAAAATTGG - Intronic
1141965612 16:87440770-87440792 CAAAAAAAAAATACAAAAATCGG - Intronic
1142045228 16:87921091-87921113 CTACTAAAAAATACAAAAATTGG - Intronic
1142097475 16:88249734-88249756 CTATAAAAAAATTAAAAAATTGG - Intergenic
1142328284 16:89432778-89432800 CTATAAAAAATTAAAAAATTTGG + Intronic
1202993951 16_KI270728v1_random:38121-38143 CAAAACAAAAATAGACAAGTAGG + Intergenic
1203011437 16_KI270728v1_random:243984-244006 CAAAACAAAAATAGACAAGTAGG - Intergenic
1203054877 16_KI270728v1_random:915257-915279 CAAAACAAAAATAGACAAGTAGG - Intergenic
1142578273 17:923934-923956 ACTTAAAAAAATACAAAAGTGGG - Intronic
1142584786 17:965271-965293 ATTTTCAAAAAGACAAAAGTGGG + Intronic
1142654412 17:1381749-1381771 CTACAAAAAAATACAAAAATTGG + Intronic
1142674129 17:1503048-1503070 CTACAAAAAAATACAAAAGTTGG - Intronic
1142819688 17:2455815-2455837 CTACAAAAAAATGCAAAAATTGG + Intronic
1142917877 17:3157254-3157276 CTATACAGAAATATAAAAAAAGG + Intergenic
1143074244 17:4326993-4327015 CTCTACTAAAATACAAAAATTGG + Intronic
1143094675 17:4472021-4472043 CTACTAAAAAATACAAAAATTGG - Intronic
1143197065 17:5084030-5084052 CTCTACAAAAATACAAAAATTGG - Intronic
1143686269 17:8518432-8518454 CAATACAAAAACACACAAGGAGG - Intronic
1143713390 17:8749564-8749586 CTCTATAAAAATACAAAACTGGG - Intergenic
1143945955 17:10592181-10592203 CTAGTTAAAAATACAAAAATTGG + Intergenic
1144120398 17:12147043-12147065 TTCTACAAACAGACAAAAGTGGG - Intergenic
1144316331 17:14065521-14065543 CTATTTAAAAATATATAAGTAGG + Intergenic
1144871335 17:18373497-18373519 CTACTAAAAAATACAAAAATTGG + Intergenic
1145197307 17:20905850-20905872 CTACAAAAAATTACAAAAATTGG - Intergenic
1145209659 17:21003733-21003755 CTCTACTAAAATACAAAAGTAGG + Intronic
1145225976 17:21128395-21128417 CTACTAAAAAATACAAAAATTGG + Intronic
1145805723 17:27727932-27727954 CTACTAAAAAATACAAAAATTGG + Intergenic
1145959348 17:28878014-28878036 CTATTAAAAACTACAAAAATGGG - Intergenic
1145984996 17:29039890-29039912 CTACTTAAAAATACAAAAATTGG - Intronic
1146041132 17:29455999-29456021 CTATCAAAAAATAGAAAAGAAGG - Intronic
1146047036 17:29517286-29517308 CTCTACTAAAATACAAAATTAGG - Intronic
1146192626 17:30783314-30783336 ATTTAAAAAAATACAAAAATTGG + Exonic
1146930889 17:36777069-36777091 CTAAAAAAAAATACAAAAAAAGG - Intergenic
1146981460 17:37165839-37165861 CTACAAAAAAATGCAAAAATTGG - Intronic
1147284423 17:39390254-39390276 CTACAAAAAAATACAAAAATTGG + Intronic
1147404148 17:40198956-40198978 CTACAAAAAAATAAAAAAATAGG + Intergenic
1147501139 17:40964894-40964916 CTACTAAAAAATACAAAAATTGG + Intronic
1147599421 17:41736611-41736633 CTACAAAAAAATACAAGAATTGG + Intergenic
1147781203 17:42943558-42943580 CTACAAAAAAATACAACAATTGG - Intergenic
1147955443 17:44131291-44131313 CTACTAAAAAATACAAAAATTGG + Intergenic
1148010890 17:44480413-44480435 CTACTAAAAAATACAAAAATTGG + Intronic
1148077244 17:44945223-44945245 CTATAAAAAAATTTAAAATTGGG - Intronic
1148089024 17:45011599-45011621 CTACTAAAAAATACAAAAGTAGG + Intergenic
1148506670 17:48132755-48132777 CTCTATAAAAATACAAAAATTGG + Intergenic
1148540973 17:48480185-48480207 CTACAAAAAAATACAAAAATTGG + Intergenic
1148570054 17:48661146-48661168 CTACTAAAAAATACAAAACTAGG - Intergenic
1148723643 17:49773003-49773025 CTACTAAAAAATACAAAAATTGG + Intronic
1148881492 17:50731332-50731354 CTCTACAAAAATACAAAAACTGG - Intronic
1148903527 17:50896655-50896677 CTACAAAAATATACAAAAATTGG + Intergenic
1148911077 17:50943229-50943251 CTCCACAAAAATACAAAAATTGG - Intergenic
1148919742 17:51019887-51019909 CTATAGCAAAATACCAGAGTGGG - Intronic
1149280542 17:55100476-55100498 TTAAACAAATATACAAAAGATGG + Intronic
1149440168 17:56667214-56667236 CTATACAAATATAAGCAAGTAGG - Intergenic
1149586225 17:57789257-57789279 CTCTTGAAAAATACAAAAGAAGG - Intergenic
1149589382 17:57817260-57817282 ATATAAAAAAAAAAAAAAGTAGG - Intergenic
1149807238 17:59630164-59630186 CTACAAAAAAATACAAAAATTGG - Intronic
1150048843 17:61939205-61939227 TTATTCAAAAATACTCAAGTTGG + Intergenic
1150092864 17:62344782-62344804 ATATATAAAAATTCAAAAATAGG - Intergenic
1150093666 17:62353199-62353221 CTCTACAAAAAAAAAAAATTAGG + Intergenic
1150117268 17:62564235-62564257 CTACTAAAAAATACAAAAATTGG + Intronic
1150244075 17:63660755-63660777 CTAAAAAAAAATACAAAATTAGG - Intronic
1150465682 17:65390907-65390929 CTCTGCAAAAATAAAAAAATTGG + Intergenic
1150648785 17:66996543-66996565 CTACCAAAAAATACAAAAATTGG - Intronic
1150921334 17:69486805-69486827 CTATTGAAGAATACAAAACTTGG + Intronic
1150979898 17:70129174-70129196 ATGTAAAAAATTACAAAAGTAGG + Intronic
1151279472 17:73062295-73062317 ATAAAAAAAAATACAAAAATTGG + Intronic
1151698179 17:75728682-75728704 CTACTAAAAAATACAAAAATTGG + Intronic
1151751779 17:76043096-76043118 CTCTACAAAAAAATAAAAATTGG + Intronic
1151774651 17:76191309-76191331 CTACAAAAAAATAAAAAATTAGG + Intronic
1152515719 17:80822978-80823000 CTATCAAAAATTACTAAAGTTGG - Intronic
1152576967 17:81146021-81146043 CTACAAAAAAATACAAAAATTGG + Intronic
1152672500 17:81617507-81617529 CTACTTAAAAATACAAAATTAGG + Intronic
1152826917 17:82472316-82472338 CTACTAAAAAATACAAAAATTGG + Intronic
1153218790 18:2844716-2844738 ATAAATAAAAATACAAAAGAGGG + Intergenic
1153247833 18:3091013-3091035 CTATATAAAAATAGAAAAATAGG + Intronic
1153462992 18:5357488-5357510 CTATATCAAAATAAAAAATTTGG + Intergenic
1153852860 18:9112646-9112668 CTACCAAAAAATACAAAAATTGG - Intronic
1154930066 18:20984946-20984968 CTACAAAAAAATACAAAAATTGG + Intronic
1155027402 18:21954499-21954521 CTAAACAAAAAGAACAAAGTTGG + Intergenic
1155097530 18:22572598-22572620 CTTATTAAAAATACAAAAGTTGG + Intergenic
1155194050 18:23456094-23456116 CTACACAAAAATACAAAAATTGG - Intronic
1155319425 18:24604502-24604524 CAACAAAAAAATACACAAGTGGG - Intergenic
1155405235 18:25480608-25480630 CAAAACAAAAAAACAAAAGCAGG + Intergenic
1155749753 18:29406725-29406747 ATAAACAAACATACAATAGTGGG - Intergenic
1156306832 18:35885256-35885278 CTCTACTAAAATACGAAAGTTGG + Intergenic
1156650697 18:39223336-39223358 CAATTTAAAAATTCAAAAGTGGG + Intergenic
1156865923 18:41888526-41888548 CTACTAAAAAATACAAAAATTGG + Intergenic
1156870791 18:41942566-41942588 CAATACAGTAATACTAAAGTTGG + Intergenic
1156934385 18:42685350-42685372 CGAAACAAAAATAGACAAGTGGG + Intergenic
1157969373 18:52248647-52248669 CTTTAAAAAAATAGTAAAGTGGG + Intergenic
1158098496 18:53803034-53803056 CTATACATAAATTCACTAGTAGG + Intergenic
1158268460 18:55686179-55686201 CTCTACAAAAAATAAAAAGTTGG + Intergenic
1158496693 18:57961459-57961481 CAAAACAAAAATATAAAAATAGG + Intergenic
1158713671 18:59859414-59859436 CTATAACAAAATAGAAAAGTCGG - Intergenic
1158740445 18:60135856-60135878 CTTTAAAAAAAAAAAAAAGTTGG + Intergenic
1158748757 18:60233507-60233529 CTAAACCAAAAGAAAAAAGTAGG - Intergenic
1158979291 18:62743330-62743352 TTAAACACAATTACAAAAGTAGG + Intronic
1159147565 18:64473754-64473776 TTATACAAATATCCTAAAGTAGG - Intergenic
1159286660 18:66362657-66362679 CTATAGAAAAATAAAAGATTGGG + Intergenic
1159701077 18:71628545-71628567 CAATAAAAAAATACATAAATTGG + Intergenic
1160214935 18:76920384-76920406 CTACTAAAAAATACAAAATTAGG + Intronic
1160279652 18:77476034-77476056 GCAAACAAAAATATAAAAGTGGG + Intergenic
1160626617 18:80212717-80212739 CTACTAAAAAATACAAAAATTGG + Intronic
1161434178 19:4252296-4252318 CTAAAAAAAAATACAAAAATAGG + Intronic
1161475331 19:4481624-4481646 CTACTAAAAAATACAAAAATTGG - Intronic
1162285329 19:9734656-9734678 TTAAACAAAAAGACAAAAATGGG - Intergenic
1162309843 19:9899715-9899737 CTAAAAAAAAATACAGAAATTGG - Intronic
1162330139 19:10023024-10023046 CTTTAAGAATATACAAAAGTTGG - Intergenic
1162368903 19:10267215-10267237 TAAAATAAAAATACAAAAGTTGG + Intergenic
1162423651 19:10580797-10580819 CTATAAAAAATTTAAAAAGTAGG + Intronic
1162436053 19:10659692-10659714 CTATATAAAAATACAAAAATTGG - Intronic
1162455216 19:10779952-10779974 CTTTAAAAAAACACAAAAGAAGG - Intronic
1162556927 19:11392817-11392839 CTACAAAAAAATACAAAGATTGG - Intronic
1162591433 19:11594919-11594941 CTACAAAAAAATACAAAAATTGG - Intronic
1162615246 19:11794690-11794712 CTAAACAAAAAGAACAAAGTTGG - Intergenic
1162715143 19:12626313-12626335 CTACTAAAAAATACAAAAATTGG - Intronic
1162723936 19:12678601-12678623 CTGTAGAAAAATACAAAAATTGG + Intronic
1162858700 19:13489452-13489474 CTACAAAAAAATACAAAAATTGG - Intronic
1162939285 19:13998316-13998338 CTCTATAAAAATACAAAAATTGG + Intronic
1163207539 19:15814667-15814689 GTACAAAAAAATACAAAAATTGG - Intergenic
1163428748 19:17254041-17254063 CTACTAAAAAATACAAAAATTGG + Intronic
1163473803 19:17513227-17513249 CTAAAAAAAAATACAAAAATTGG + Intronic
1163493685 19:17632209-17632231 CTCTACAAAAATACAAAAATTGG - Intronic
1163535949 19:17876561-17876583 CTACTAAAAAATACAAAATTAGG + Intronic
1163588898 19:18179577-18179599 CTACTAAAAAATACAAAAGTTGG + Intergenic
1163732420 19:18956905-18956927 CTACTAAAAAATACAAAAATTGG - Intergenic
1164042872 19:21509171-21509193 CTCTACTAAAATACAAAAATAGG - Intronic
1164387287 19:27783911-27783933 CCCTAGAAAAATACAATAGTTGG - Intergenic
1164404146 19:27927559-27927581 CTGCACAAAAATATAAATGTTGG + Intergenic
1164568028 19:29343248-29343270 CTATCCAAAAATAGAAGAGTAGG + Intergenic
1164623851 19:29714196-29714218 CTACTAAAAAATACAAAAATTGG + Intronic
1164631364 19:29763953-29763975 CACTAAAAAAATACAAAATTAGG - Intergenic
1165035613 19:33031543-33031565 CTATACAAAAAAATAAAATAAGG - Intronic
1165284110 19:34825112-34825134 CTCTACAAAAATTAAAAAATTGG + Intergenic
1165288934 19:34867542-34867564 CTTTATAAAAATACAAAAATTGG + Intergenic
1165355457 19:35301032-35301054 CTATAAAAAAATAGAAAAATTGG - Intronic
1165646029 19:37438230-37438252 CTACAAAAAAATAAAAAATTAGG + Intronic
1165927141 19:39333987-39334009 CTCTACAAAAAAAAAAAAGGGGG - Intronic
1165942049 19:39419575-39419597 CTACTAAAAAATACAAAATTAGG + Intronic
1165973633 19:39655539-39655561 CTAAACAAGAAAAAAAAAGTTGG - Intergenic
1166038724 19:40189596-40189618 CTACAAAAAAATAAAAAATTAGG - Intergenic
1166085513 19:40472207-40472229 CTACAAAAAAATACAAAAATTGG - Intronic
1166192578 19:41184953-41184975 CTTTAAAAAAAAAAAAAAGTAGG + Intergenic
1166215104 19:41329784-41329806 CTCTACTAAAATACAAAAAAAGG - Intronic
1166232600 19:41433931-41433953 CTATGAAAAAATACAAAAATTGG + Intronic
1166439453 19:42798786-42798808 CTATACAATAACAAAACAGTGGG + Intronic
1166457493 19:42954337-42954359 CTATACAATAACAAAACAGTGGG + Intronic
1166467817 19:43048766-43048788 CTATACAATAACAAAACAGTGGG + Intronic
1166474434 19:43109556-43109578 CTATACAATAACAAAACAGTGGG + Intronic
1166488406 19:43234631-43234653 CTATACAATAACAAAACAGTGGG + Intronic
1166495081 19:43295109-43295131 CTATACAATAACAAAACAGTGGG + Intergenic
1166796048 19:45426792-45426814 CTACAAAAAAACACAAAAATTGG + Intronic
1167217234 19:48172680-48172702 CTCTACAAAAATCCAAAAATTGG - Intronic
1167222290 19:48208115-48208137 ATTTACAAAAATAAAAAAATAGG - Exonic
1167343619 19:48931368-48931390 CTCTACCAAAAAAAAAAAGTGGG - Intergenic
1167480718 19:49729229-49729251 CTACTAAAAAATACAAAAATTGG - Intergenic
1167785461 19:51632124-51632146 AAATACAAAAATACAAAATTTGG - Intronic
1168024302 19:53632608-53632630 CTCTATAAAGATACAAAACTTGG - Intronic
1168032015 19:53687863-53687885 CTGTAAAAAAATACAAATGTAGG - Intergenic
1168044512 19:53784813-53784835 ATATTCAAAAATACAAACGTTGG + Intergenic
1168154627 19:54465799-54465821 CTCTACAAAAATACAAAAATTGG - Intronic
1168216676 19:54931255-54931277 CTACTAAAAAATACAAAAATCGG + Intronic
1168608070 19:57775766-57775788 CTCTACTAAAATACAAAAATTGG - Intronic
925261652 2:2534655-2534677 CTACTGAAAAATACAAAAATTGG - Intergenic
925548816 2:5047224-5047246 CTAATCAAAAAGAAAAAAGTTGG - Intergenic
926028442 2:9565001-9565023 CTATAAAAAAATTAAAAAATTGG - Intergenic
926103932 2:10138465-10138487 CTACTAAAAAATACAAAAATTGG - Intergenic
926898180 2:17718527-17718549 GTATACAATAATACTAAAGTAGG + Intronic
927014848 2:18948996-18949018 AGATAAAAAAAAACAAAAGTGGG + Intergenic
927046507 2:19284327-19284349 CTATACAAAAAGAACAAAGCTGG + Intergenic
927348267 2:22073364-22073386 CTAAGCAAAAAAACAAAACTGGG + Intergenic
927352093 2:22127593-22127615 CTATAAAGAAAAACAAAAGCTGG + Intergenic
927625936 2:24718668-24718690 CTAAAAAAAAATACAAAACTAGG + Intronic
927727158 2:25434572-25434594 CTATACAGCAATAAAAAAGAAGG - Intronic
927970128 2:27300471-27300493 CTATGTAAAAATAAAAAATTAGG - Intronic
928105515 2:28468290-28468312 CTCTACAAAAAAAAAATAGTTGG - Intronic
928162688 2:28942779-28942801 TTACAAAAAAATACCAAAGTTGG - Intronic
928177011 2:29041188-29041210 CTCTACTAAAAGACAAAAATTGG - Intronic
928361654 2:30667056-30667078 CAATACATAAATCCAAAAGCTGG - Intergenic
929105336 2:38359825-38359847 CTTAAAAAAAATACTAAAGTTGG + Intronic
929299727 2:40289180-40289202 CTACAAAAGAATAAAAAAGTAGG + Intronic
929681917 2:44000209-44000231 CTCTACTAAAATACAAAAATTGG - Intergenic
929903368 2:46025073-46025095 CTGTAAAAAAAAACAAATGTAGG + Intronic
930193203 2:48481420-48481442 CTATAGAAAAATCCAAGAGATGG + Intronic
930476039 2:51883305-51883327 CTAAACAAAAACAACAAAGTTGG - Intergenic
930487767 2:52028969-52028991 AAATAAAAAAAGACAAAAGTAGG - Intergenic
930543422 2:52736180-52736202 CTATACAAAAATAGCAAAGCTGG - Intergenic
930558177 2:52926643-52926665 CAATACAAAAAAAAATAAGTGGG - Intergenic
930855812 2:56017003-56017025 TTAAATAAAAATAGAAAAGTGGG - Intergenic
931276711 2:60750359-60750381 CTATATAAAAATCCATGAGTCGG + Intergenic
931360601 2:61574659-61574681 CTACAAAAAAATACAAAAATTGG + Intergenic
931552025 2:63457027-63457049 CAAAACAAAAAAAGAAAAGTTGG + Intronic
931875182 2:66504397-66504419 CACTAAAAAAATACAAAAATTGG - Intronic
932157265 2:69429393-69429415 CTACAAAAAAATACAAAAATTGG + Intronic
932240838 2:70155496-70155518 CTTTTGAAAAATACAAAATTAGG + Intronic
932768385 2:74485768-74485790 CTGTACAAAAATACAAAATTGGG - Intronic
933368302 2:81384481-81384503 TTGTCCAAAAACACAAAAGTAGG - Intergenic
933447630 2:82402450-82402472 CTAAGCAAAAATAAAAAAGCTGG - Intergenic
933471411 2:82730338-82730360 CTTTATAAAAATACAAAAATTGG + Intergenic
933481153 2:82858630-82858652 ATTTAAAAAAATACAAAAGCAGG + Intergenic
933636010 2:84709602-84709624 CTATTAAAAATTATAAAAGTGGG + Intronic
933746436 2:85575167-85575189 CTATAAAAAAATAAAACTGTTGG - Intronic
933882307 2:86681703-86681725 CTCTACTAAAATACAAAACTTGG - Intronic
934071710 2:88390263-88390285 CTCTACTAAAATATAAAAATTGG + Intergenic
934120552 2:88834238-88834260 ATATTCAAAAAGGCAAAAGTAGG - Intergenic
934605736 2:95693875-95693897 CTATAATAAAATAAAAAATTTGG - Intergenic
934969444 2:98751022-98751044 CTATAATAAAATACCAAAGATGG - Intergenic
935079221 2:99776033-99776055 CGATAAAATAATACAACAGTAGG + Intronic
935116873 2:100144439-100144461 AGATACAAAATTAGAAAAGTGGG + Intergenic
935180339 2:100683695-100683717 CACTACAAAAATAAAGAAGTAGG + Intergenic
935454595 2:103252632-103252654 GTATACAAAAATACAGATTTGGG - Intergenic
936272015 2:111056197-111056219 CTTTAAAAAAAAAAAAAAGTTGG + Intronic
937358890 2:121215306-121215328 AAATACAAAAATACAAAAATGGG + Intergenic
937585336 2:123540779-123540801 CTAAGCAAAAATAACAAAGTCGG - Intergenic
937838548 2:126498799-126498821 CTAATAAAAAATAAAAAAGTTGG - Intergenic
938008427 2:127808728-127808750 CTACTAAAAAATACAAAAATTGG + Intronic
938355036 2:130637733-130637755 CTAAAAAAAAAAATAAAAGTAGG + Intronic
938592188 2:132750305-132750327 ATATATAAAAATTCAAAAGATGG + Intronic
939291421 2:140200852-140200874 TTAGACATAAATACAAAATTGGG - Intergenic
939291958 2:140207214-140207236 CTCTACAAAAAATCAAAAATTGG + Intergenic
939308465 2:140440119-140440141 CTATAGATAAATACAAATATTGG + Intronic
939476100 2:142688548-142688570 ATTTACAAAAATAAAATAGTCGG + Intergenic
939681338 2:145137705-145137727 ATATAAAAATATACAAAATTGGG + Intergenic
939707350 2:145471323-145471345 CTCTACAAAAATACAAAAATTGG + Intergenic
939769057 2:146291906-146291928 CTACTAAAAAATACAAAAATTGG + Intergenic
940029932 2:149251171-149251193 ATATACAAAATAACAAATGTTGG - Intergenic
940283058 2:152007143-152007165 ATACACAAAAATACAATAGGTGG - Intronic
940290971 2:152077252-152077274 CTCTACTAAAATATAAAAATTGG + Intronic
940651998 2:156449851-156449873 ATATACAAAAAAAAAAAAGCCGG + Intronic
940942130 2:159573933-159573955 CTACAAAAAAATATAAAAATTGG + Intronic
941120203 2:161521073-161521095 TTACAAAAAAATACAGAAGTCGG - Intronic
941286747 2:163623062-163623084 CTACACAAAAATTCAAATCTGGG + Intronic
941436767 2:165482427-165482449 CTACAAAAAAATACAAAAACTGG - Intronic
941445903 2:165599453-165599475 CTACAAAAAAATACAAGAATTGG - Intronic
941453021 2:165682190-165682212 CTAGCCAAAAATAAAAAAGTAGG - Exonic
941545014 2:166838552-166838574 ATATACAAAAGTAGAAAAGTTGG + Intergenic
941909957 2:170755345-170755367 CTACAAAAAAATACAAAAACTGG + Intergenic
942060500 2:172224767-172224789 ATATTAAAAAATATAAAAGTTGG - Intergenic
942673784 2:178405320-178405342 CTCTACTAAAACACAAAATTAGG - Intergenic
943240640 2:185379213-185379235 CTAAACAAAAAGAAAAAAGCTGG + Intergenic
943713815 2:191127794-191127816 CTTTACAAAAATAAAAAATCAGG + Intronic
943955726 2:194187109-194187131 CTCTACAAAAATAGATAAGTGGG - Intergenic
943992629 2:194716319-194716341 CAAAACAAAAGTACAAAACTAGG + Intergenic
944014333 2:195015988-195016010 CAATTCAAAAATACAATTGTTGG + Intergenic
944241876 2:197493798-197493820 CTATTAAAAAATTCAAAAATTGG + Intronic
944315853 2:198285168-198285190 CTATACAAACCAACATAAGTTGG - Intronic
944409327 2:199422386-199422408 ATATACAAATATACAAAAATAGG + Intronic
944603929 2:201332412-201332434 CTCTGCAAAAATACAAAAATTGG - Intronic
944716842 2:202383378-202383400 CTCTACTAAAATACAAAATTAGG + Intronic
944737690 2:202582785-202582807 CAATACAACAGTACAATAGTAGG - Intergenic
944792553 2:203146344-203146366 CTCTTCAAAAATAGAAAAGTAGG + Intronic
944861623 2:203820623-203820645 CTCCACTAAAATACAAAAATTGG + Intergenic
944878762 2:203989840-203989862 CAATATAAAAATACAAAAAATGG - Intergenic
945384763 2:209184083-209184105 CCAAACAAAAATACACAAATAGG - Intergenic
945529869 2:210939015-210939037 TTATTCAATAATATAAAAGTGGG - Intergenic
945577512 2:211550150-211550172 CTATACACATACACAAAAATGGG - Intronic
945599516 2:211841879-211841901 CTAGACAAATATTTAAAAGTTGG + Intronic
945622269 2:212155303-212155325 TTATAAAAAAGTTCAAAAGTTGG + Intronic
945815977 2:214605350-214605372 CCTTAAAAAAATACAAAATTAGG + Intergenic
946208754 2:218130252-218130274 CTCTACTAAAATACAAAAATTGG + Intronic
946687704 2:222288126-222288148 TTAAACAAACAAACAAAAGTCGG + Intronic
946768592 2:223063582-223063604 CTGTTCTAAAATATAAAAGTTGG - Intronic
946887122 2:224232686-224232708 CTAAGCAAAAATAAAAAATTTGG - Intergenic
947203076 2:227633581-227633603 CTACCAAAAAATACAAAAATTGG + Intergenic
947211225 2:227710393-227710415 CTCTACAAAAATACAAAATAAGG + Intronic
947265679 2:228277435-228277457 CTATCAAAAAATACAAAAATTGG + Intergenic
947421043 2:229941848-229941870 CTCTACTAAAATACAAAAATTGG + Intronic
948875986 2:240828767-240828789 CTCTACAAAAATACAAAACTTGG + Intergenic
1168984073 20:2032665-2032687 CTGTACAAAAAAACCAAAGATGG + Intergenic
1169133733 20:3182896-3182918 CTCTACAAAAATACAAAAATTGG + Intergenic
1169135875 20:3196916-3196938 CTATACAAATATAAAAAAAATGG + Intronic
1169174077 20:3493459-3493481 CTCTACAAAAAAATAAAAATAGG - Intronic
1169201983 20:3715454-3715476 CTACAAAAAAATACAAAAATTGG - Intergenic
1169222071 20:3830026-3830048 CTACAAAAAAATATAAAAATTGG + Intergenic
1169225048 20:3851018-3851040 CTACTAAAAAATACAAAAATTGG + Intronic
1169260942 20:4137366-4137388 CTCTATAAAAATAAAAAAATTGG + Intronic
1169280827 20:4265527-4265549 CTCTACAAAAATACAAACATTGG + Intergenic
1169439644 20:5623420-5623442 CTACAAAAAAATACAAAAATTGG - Intergenic
1169726593 20:8740576-8740598 CTAAACATACATACGAAAGTAGG - Intronic
1169948464 20:11014979-11015001 CTATATAAAAAGTAAAAAGTGGG + Intergenic
1170636490 20:18109836-18109858 CTACAAAAAAGTACAAAAATTGG - Intergenic
1171974012 20:31582409-31582431 CTCTAAAAAAATACAAAAATTGG + Intergenic
1171974340 20:31584706-31584728 CTACAAAAAAATACAAATATTGG + Intergenic
1172003098 20:31796138-31796160 CTTTTCAGAAATATAAAAGTAGG + Intronic
1172136905 20:32692781-32692803 CTACTAAAAAATACAAAAATTGG + Intergenic
1172333859 20:34097553-34097575 CCCTACTACAATACAAAAGTGGG + Intronic
1172495874 20:35383682-35383704 CTCTACAAAAATTTAAAAATTGG + Intronic
1172575253 20:36002589-36002611 TTATACAAAAATAAAAATGTTGG - Intronic
1172607536 20:36224479-36224501 CTCTACTAAAATACAAAATTAGG + Intronic
1172675676 20:36669663-36669685 CTTTATAAAAATTCAAAAATCGG - Intronic
1173198280 20:40934057-40934079 ATACACAAGAATGCAAAAGTGGG + Intergenic
1173210333 20:41027561-41027583 CTACAAAAAAATACAAAAACTGG - Intergenic
1173289355 20:41700873-41700895 CTCCACTAAAATACAAAAATTGG - Intergenic
1173408118 20:42785017-42785039 CTATACAAAAAAAGTTAAGTTGG + Intronic
1173489556 20:43468767-43468789 CTACAAAAAAATAGAAAAATTGG + Intergenic
1174044327 20:47722763-47722785 CTCTACTAAAGTACAAAAATTGG + Intronic
1174241468 20:49138798-49138820 TTAAACAAAAATACAAGTGTGGG - Intronic
1174716649 20:52766144-52766166 CTACTAAAAAATACAAAAATTGG - Intergenic
1175117411 20:56692484-56692506 CTCTACAAAAATACAAAAATTGG - Intergenic
1176631618 21:9144310-9144332 CTCTACAAAAATACAAAAATTGG - Intergenic
1176904095 21:14479100-14479122 TTAAAAAAAAATACAAAAATTGG + Intergenic
1176919614 21:14671699-14671721 CTATATAAGAATAGAAAATTGGG + Intergenic
1176932297 21:14828345-14828367 CTATAAAATAATACAAGAGCAGG + Intergenic
1176948097 21:15008589-15008611 CTAGACATTAATAGAAAAGTGGG + Intronic
1177114832 21:17073161-17073183 TTCTACTAAAATACAAAATTAGG + Intergenic
1177166514 21:17611396-17611418 ATATAAAAAAATAGAAAAGAAGG + Intronic
1177268392 21:18812878-18812900 CTCTATAAAAATACAAAAATTGG - Intergenic
1177390411 21:20461476-20461498 CAAAACAAAAATAAACAAGTGGG + Intergenic
1177428573 21:20959271-20959293 CTAAACAAAAAGACCAAAGCTGG + Intergenic
1177650698 21:23957597-23957619 GTCTACAAAAATACATAATTAGG - Intergenic
1178474801 21:32928414-32928436 CTATAAAAAAATACAAAAATTGG - Intergenic
1178479849 21:32970410-32970432 CTATTCCATAAAACAAAAGTTGG + Intergenic
1178536767 21:33416520-33416542 CTGTAAAAGAATAGAAAAGTAGG + Intronic
1178669368 21:34577431-34577453 CTACAAAAAAATACAAAAATTGG + Intronic
1179035923 21:37758793-37758815 CTACAAAAAAACAAAAAAGTAGG - Intronic
1179368086 21:40777502-40777524 AAATATAAAAATACAAACGTTGG + Intronic
1179785301 21:43726572-43726594 CTCTACCAAAATACAAAAATTGG - Intronic
1179830866 21:43995033-43995055 CTCTACAAAAATAAAAAAATTGG + Intergenic
1180638009 22:17276111-17276133 CAATACAATAATACAATAGCTGG + Intergenic
1180672660 22:17565379-17565401 CTATTAAAAAATAGAAAATTTGG - Intronic
1181298973 22:21866220-21866242 CTACTAAAAAATACAAAAATGGG + Intronic
1181300601 22:21878216-21878238 CTTTAAAAAAAAAAAAAAGTCGG + Intergenic
1181641813 22:24205045-24205067 CTACAAAAAAATACAAAAATTGG - Intergenic
1181704196 22:24638558-24638580 CTAAAAAAGAATACAAAAATTGG - Intergenic
1181996919 22:26890246-26890268 CTCTACAAAAATACAAAAACTGG - Intergenic
1182579271 22:31294683-31294705 CTCTACAAAAAAAAAAAAATAGG + Intergenic
1182636298 22:31729980-31730002 CTCTACTAAAATACAAAATTAGG + Intronic
1182638020 22:31744431-31744453 ATCTACAAAAATAAAAAAGTAGG - Intronic
1182915953 22:34030582-34030604 CTCTACAAAAATACAAAATTAGG - Intergenic
1183012753 22:34960739-34960761 ATATATAAAAGTACAAAATTGGG + Intergenic
1183202426 22:36394850-36394872 CTACAATAAAATACAAAAATTGG - Intergenic
1183278201 22:36914680-36914702 CTGTACAAAAATATAACAGCAGG - Intronic
1183468832 22:37994804-37994826 CTACAAAAAAATACAAAAATTGG - Intronic
1183843599 22:40521662-40521684 CTATACTAAAATACAAAAATTGG - Intronic
1184157477 22:42677626-42677648 CTCTACTAAAATACAAAAATTGG + Intergenic
1184199941 22:42961605-42961627 CTACTAAAAAATACAAAAATTGG + Intronic
1184373247 22:44096057-44096079 CTACTAAAAAATACAAAAATTGG + Intronic
1185183658 22:49379430-49379452 AAAAACAAAAAAACAAAAGTGGG + Intergenic
949172065 3:1012457-1012479 GTTTACAAAAATACAGAATTTGG - Intergenic
949272184 3:2230819-2230841 TTATAAAAAAATACCAAAATTGG + Intronic
949470741 3:4393495-4393517 CTATAAAAAAATAAAATATTAGG - Intronic
949765113 3:7517556-7517578 CTACAAAAAAATACAAAAATTGG - Intronic
950248309 3:11441965-11441987 TTATAAAAAAATACAAAAATTGG - Intronic
950350523 3:12346798-12346820 CTATAAAAAAATAAAATAATTGG - Intronic
950402608 3:12781451-12781473 CTCTACTAAACTACAAAAATTGG - Intergenic
950826076 3:15822901-15822923 CTAAAATAAAAAACAAAAGTAGG + Intronic
950927965 3:16761418-16761440 CTCTACTAAAATACAAAAACCGG - Intergenic
951284966 3:20799591-20799613 CTGAACAAAAATACCAAAGCTGG - Intergenic
951292048 3:20883097-20883119 CTTTTCAAAAATACAAAATGTGG + Intergenic
951312343 3:21143155-21143177 CTACATAAAAATACAAAATTAGG - Intergenic
951369089 3:21822403-21822425 CTTTTCAAAAATTAAAAAGTTGG + Intronic
951857064 3:27209377-27209399 CTTTACAAAAATAGCAAAGCAGG + Intronic
951863474 3:27279999-27280021 CTCTCCTAAAATACAAAAATTGG + Intronic
952024436 3:29061769-29061791 AAATACAAAAATAAAAAAGTTGG + Intergenic
952352444 3:32553167-32553189 CTACAAAAAAATAGAAAAATTGG + Intronic
952794502 3:37226966-37226988 CTCTACAAAAATTAAAATGTTGG + Intergenic
952825869 3:37524417-37524439 CTGTACAAAAATACACAATGTGG - Intronic
953009263 3:39008720-39008742 CTCTACTAAAATACAAGGGTGGG + Intergenic
953050609 3:39339127-39339149 ATAAATAAAAATACAAAAGGTGG - Intergenic
953475526 3:43202747-43202769 CTACTAAAAAATACAAAAATTGG + Intergenic
954048489 3:47952756-47952778 CTACTAAAAAATACAAAAATTGG + Intronic
954268719 3:49490732-49490754 CTACAAAAAAATACAAAATTAGG - Intronic
954302829 3:49709598-49709620 CTAAAAAAAAATACAAAATTAGG - Intronic
954391957 3:50272408-50272430 CTACTAAAAAATACAAAAATTGG + Intronic
954394045 3:50283325-50283347 TTATCAAAAAATACAAAAATTGG + Intronic
954544585 3:51422095-51422117 AAAAACAAAAATACAAATGTAGG - Intronic
954665813 3:52251283-52251305 CTCTACAAAAAATAAAAAGTTGG - Intergenic
954944870 3:54413256-54413278 AGATACAAAGATACAAATGTTGG - Intronic
955213752 3:56966277-56966299 CTATACAAAGATACAGAATTAGG + Intronic
955290485 3:57688157-57688179 TAATAAAAAAATACAAAAATAGG - Intronic
955597102 3:60603187-60603209 ATATAAAAACATTCAAAAGTTGG - Intronic
955638583 3:61057279-61057301 CCACATGAAAATACAAAAGTAGG - Intronic
955716691 3:61837078-61837100 CTTTACAAAAATACAAAAATTGG - Intronic
955809754 3:62775201-62775223 AAATACAAAAATACAAAAATTGG - Intronic
955925668 3:64002052-64002074 CAAAATAAAGATACAAAAGTAGG - Exonic
956481982 3:69682186-69682208 CTTTAAAAAAATACAAAAATTGG + Intergenic
956637222 3:71378256-71378278 CAATACATAAATACCAAAGAAGG + Intronic
957382363 3:79448589-79448611 CTCTCCAGAAATACAAATGTGGG - Intronic
957599351 3:82313084-82313106 TTTTAGAAAAATAGAAAAGTGGG - Intergenic
957700731 3:83707687-83707709 CAATAAAAAAATTAAAAAGTTGG - Intergenic
957856474 3:85885370-85885392 CTACTAAAAAATACAAAATTAGG + Intronic
957961891 3:87266677-87266699 CTATATAATAAAAGAAAAGTTGG - Intronic
958925620 3:100154014-100154036 CTCTACAAAAATACAAAAATTGG - Intronic
958953529 3:100441964-100441986 CTATATAAAAATATAAAGCTAGG - Intronic
959048393 3:101499833-101499855 CTCTACAAAAATACAAAAATTGG - Intronic
959066585 3:101663236-101663258 CTCTACAAAAATACAAAAATTGG - Intronic
959125858 3:102290105-102290127 CTAAACAAAAATACAAACAAGGG - Intronic
959140066 3:102475003-102475025 CTTTGCAATAATACAAAAATTGG + Intronic
959180002 3:102966886-102966908 ATATACAAATATACAAAGATTGG - Intergenic
959209791 3:103363248-103363270 CTAAACAAAAATAACAAAGCTGG + Intergenic
959510048 3:107200420-107200442 GTATACAAAAAACAAAAAGTTGG + Intergenic
959536774 3:107495612-107495634 CTATATAAAAATATAAAACTTGG - Intergenic
959588371 3:108048281-108048303 TGACACAAACATACAAAAGTAGG + Intronic
959750921 3:109834049-109834071 TTATACTAAAAAACAAATGTTGG - Intergenic
959775648 3:110159124-110159146 TTAAACAAACAAACAAAAGTAGG - Intergenic
959975723 3:112456719-112456741 ATATACATAAATTCAAAACTTGG + Intergenic
960077988 3:113510321-113510343 CTAAACAAAAAGAACAAAGTTGG + Intronic
960430825 3:117566635-117566657 CTATAGAAAACTTTAAAAGTAGG - Intergenic
960526034 3:118711320-118711342 CTATAAAACAATGCAAAATTTGG + Intergenic
960878598 3:122321855-122321877 AAATAAAAAAATAAAAAAGTGGG - Intergenic
961152586 3:124651936-124651958 CTAAACAAGAAAACAAAAGTTGG - Intronic
961205904 3:125081367-125081389 CTATACCAAATTACATAAATCGG - Intergenic
961623315 3:128241509-128241531 CTCTACAAAAATACAAAAATTGG - Intronic
961911425 3:130320831-130320853 ATAAACAAAAAAACAAAAGGCGG - Intergenic
961967441 3:130920196-130920218 CAAAACAAAAATAAACAAGTGGG - Intronic
962074000 3:132061485-132061507 CTAAGCAAAAATAAAAAAGCTGG - Intronic
962103149 3:132363769-132363791 CTCTATTAAAATACAAAAATTGG + Intronic
962295273 3:134178074-134178096 CTATAAAATAATAAAAAATTGGG + Intronic
962531853 3:136288966-136288988 CTCTACAAAAATAAAAAAATTGG - Intronic
962786365 3:138771748-138771770 CTCTACAAAAATTTAAAAATTGG + Intronic
962789753 3:138800482-138800504 CCCTACAAAAAAAAAAAAGTCGG - Intronic
962791464 3:138815189-138815211 ATACAAAAAAATACAAAAATTGG + Intronic
962803882 3:138913531-138913553 CTAACAAAAAATACAAAAATTGG + Intergenic
963204298 3:142616766-142616788 CTCTACTAAAATATAAAAATTGG - Intronic
963219124 3:142787413-142787435 CAAAACAAATATACAAAAATTGG - Intronic
963441035 3:145340715-145340737 ACATACAAAAACAAAAAAGTAGG - Intergenic
963856601 3:150260077-150260099 CTATAGAAAAATACATAAGCAGG - Intergenic
963888719 3:150609512-150609534 CTACAAAAAAATACAAAAATTGG - Intronic
964576216 3:158171589-158171611 CTAAACAAAAATACAAAGAATGG + Intronic
964942722 3:162179207-162179229 ATATAAATACATACAAAAGTGGG - Intergenic
965031468 3:163373696-163373718 CTATCAATAAATGCAAAAGTGGG + Intergenic
965422112 3:168473781-168473803 CTACAAAAAAATGCAAAAATTGG - Intergenic
965439495 3:168695418-168695440 ATATATAAAATTATAAAAGTGGG - Intergenic
965892011 3:173526171-173526193 CAATTCAATAATACAGAAGTAGG - Intronic
966049570 3:175597964-175597986 CTATACACATATACACATGTAGG - Intronic
966195614 3:177310878-177310900 CTCTACAAAAATTGAAAAGGAGG - Intergenic
966357735 3:179099827-179099849 TTACAAAAAAATACAAAAATTGG + Intergenic
966511436 3:180767573-180767595 CTACAAAAAAATACAAAAATTGG + Intronic
966715624 3:183010676-183010698 CTTAAAAAAAATACAAAAATTGG - Intergenic
966720021 3:183053320-183053342 CTCTACAAAAATAAAAAAATTGG + Intronic
967178357 3:186881777-186881799 CACTACAAAAATACAAAAACTGG - Intergenic
967389781 3:188944422-188944444 CTCTAAAAAAAAACAAAAGAAGG - Intergenic
967520110 3:190419818-190419840 CTATATAAAAATACAAAATATGG + Intergenic
968665558 4:1820100-1820122 CTTTACAAAAAATAAAAAGTTGG - Intronic
968685349 4:1954283-1954305 CTACAAAAAAATACAAAAATTGG - Intronic
968785458 4:2618894-2618916 CTACAAAAAAATACAAAAATTGG - Intronic
969409242 4:7017132-7017154 CTCTACTAAAATACAAAAATTGG + Intronic
969419115 4:7080749-7080771 CTAAGCAAAAATAAAAAAGCTGG - Intergenic
969821135 4:9721125-9721147 CTCTACCAAAAAACAAAAATTGG + Intergenic
970034132 4:11712834-11712856 ATATAACAAAAAACAAAAGTGGG + Intergenic
970216679 4:13766159-13766181 ACATACAAAAAGACAAATGTTGG + Intergenic
970619073 4:17798428-17798450 CTACAAAGAAATACAAAAATTGG + Intergenic
970695563 4:18672687-18672709 CAAAATAAAAATACAAAAGAGGG + Intergenic
970812558 4:20112471-20112493 CTACAAAAAAATAAAAAAATAGG + Intergenic
970849835 4:20588547-20588569 ATATAAAACAATTCAAAAGTAGG + Intronic
970855951 4:20649631-20649653 CTATACAGAAATACCCAAGATGG - Intergenic
970875721 4:20867653-20867675 CAAAACAAAAATAGACAAGTGGG + Intronic
971397775 4:26245505-26245527 CCATACAAAAGTACATTAGTGGG - Intronic
971407689 4:26337523-26337545 GTATAAAAAAAAAAAAAAGTTGG - Intronic
971782433 4:31054129-31054151 CTCTACAAAAACACAAAAATTGG - Intronic
971909641 4:32778835-32778857 TTATAAAAAAAAAAAAAAGTGGG + Intergenic
972571378 4:40313363-40313385 CTATTTAAAAATAGAAAAGAGGG + Intergenic
972615548 4:40694701-40694723 CTCTACAAAAATACAAACATTGG - Intergenic
972664476 4:41150903-41150925 CCCTCCAAAAATACAAAAATTGG - Intronic
972858792 4:43141238-43141260 CTAAGCAAAAAGAAAAAAGTTGG + Intergenic
973034036 4:45383307-45383329 GTATACAAATATACACATGTAGG + Intergenic
973687720 4:53390102-53390124 CTACATAAAAATACAAAAATTGG - Intronic
974573783 4:63689602-63689624 CTATTCCAAAAGAGAAAAGTTGG - Intergenic
974685421 4:65221600-65221622 CTATAGAAAAATAAAAAAATAGG - Intergenic
974776162 4:66484516-66484538 ATATACAAAAATACAATGTTTGG + Intergenic
974853047 4:67426754-67426776 CCATCCAAAAAAAAAAAAGTTGG + Intergenic
974907997 4:68080810-68080832 CTATACAAAAATAAATTAATTGG + Intronic
975194894 4:71512645-71512667 CCAAACAAAAATAGACAAGTGGG - Intronic
975333722 4:73150928-73150950 CTAAACAAAAATTTAAAAGTAGG - Intronic
975756327 4:77575290-77575312 TAATAAAAAAATAAAAAAGTTGG - Intronic
976030249 4:80743271-80743293 CTAGACAATAACAAAAAAGTAGG + Intronic
976041303 4:80887978-80888000 ATATAAAAAAATAAAAAAATAGG + Intronic
976266678 4:83191807-83191829 CTACTAAAAAATACAAAAATTGG + Intergenic
976417181 4:84790590-84790612 CAAAACAAAAATAAACAAGTGGG + Intronic
976556595 4:86457995-86458017 CTACTAAAAAATACAAAATTAGG + Intronic
976718951 4:88151837-88151859 GTATACAAAGATATAAAAGAAGG + Intronic
976917901 4:90401693-90401715 CTCTACTAAAATACAAAAATTGG - Intronic
977208605 4:94192502-94192524 ATATACAAAGATAGAATAGTAGG + Intergenic
977940083 4:102848342-102848364 CTCTACAAAAAAAGAAAAATAGG + Intronic
978444967 4:108771857-108771879 CTCTACAAAAATACAAAAACTGG - Intergenic
978724740 4:111956767-111956789 CTACACAAAAATAAAAAACTTGG - Intergenic
979043260 4:115827744-115827766 GTATACAAGAATAGAAAAGTAGG - Intergenic
979240861 4:118445873-118445895 CTACATAAAAATAATAAAGTGGG + Intergenic
979343682 4:119559481-119559503 CTATACATAAATAGAAATATAGG - Intronic
979555517 4:122042229-122042251 CTCTATTAAAATACAAAAGCTGG - Intergenic
979576410 4:122296616-122296638 CTAAGCAAAAAGAAAAAAGTTGG + Intronic
979649305 4:123111887-123111909 CTTCACAAAAATACAAAAATTGG - Intronic
979682559 4:123477908-123477930 ACTTACAAAAATAGAAAAGTGGG + Intergenic
979789592 4:124762079-124762101 GAATATAAAAATACACAAGTGGG + Intergenic
979801869 4:124919886-124919908 CTACAAGAAAATACAAAAATTGG + Intergenic
980064405 4:128168855-128168877 CTCTTCCAAAATACAAAAGAAGG - Intronic
980443217 4:132874020-132874042 CTAAACAAAAATAACAAAGCTGG + Intergenic
980914808 4:139024223-139024245 CTCTACAAAAAAATAAAAGTAGG - Intronic
981364150 4:143882458-143882480 CTTTTCAAAAATACAATAGATGG - Intronic
981385210 4:144122546-144122568 CTTTTCAAAAATACAATAGAAGG - Intronic
981473853 4:145167690-145167712 CTACTAAAAAATACAAAAATTGG + Intronic
981733310 4:147922387-147922409 CTTTAAAAAAAAAAAAAAGTTGG + Intronic
982003671 4:151044684-151044706 CTACAAAAAAATACAAAAATTGG + Intergenic
982228942 4:153190901-153190923 CTCTACTAAAATACAAAAATTGG - Intronic
982363017 4:154543311-154543333 CTACAAAAAAATACAAAAATTGG - Intronic
982448151 4:155518967-155518989 TTGTACAAACATACAGAAGTGGG - Intergenic
982527572 4:156498662-156498684 CTCTATTAAAATATAAAAGTGGG + Intergenic
982577996 4:157141556-157141578 GTATACAAAAATACTCAAATTGG + Intronic
982689678 4:158533745-158533767 GAATAGAAAAATAGAAAAGTAGG - Intronic
982748920 4:159135763-159135785 CTCTCTAAAAATACAAAAATTGG - Intronic
982760041 4:159271140-159271162 CTTTAAAAAAACACAACAGTTGG - Intronic
983025039 4:162726081-162726103 CTACTAAAAAATACAAAAATTGG - Intergenic
983199038 4:164840973-164840995 AAATATAAAAATAAAAAAGTAGG + Intergenic
983258513 4:165429534-165429556 CTCTACAAAAATACAAGAATTGG + Intronic
983314250 4:166107949-166107971 CTAACCAAAACAACAAAAGTAGG + Intergenic
983753660 4:171306787-171306809 CAATTCAAATATACAACAGTTGG - Intergenic
984204787 4:176773524-176773546 GTATACAAAAAAACAGAAGCAGG + Intronic
984207293 4:176800410-176800432 CTACTAAAAAATACAAAATTAGG - Intergenic
984469213 4:180144423-180144445 TTATACAAAGATATAAAAGGTGG - Intergenic
984777694 4:183497177-183497199 CTCTACTAAAATACAAAAATTGG - Intergenic
984883237 4:184428631-184428653 CTACAAAAAAATACAAAAATTGG + Intronic
985087812 4:186332088-186332110 ATAAACAAAAATAAAAAATTGGG - Intergenic
985176846 4:187211319-187211341 CTACAAAAAATTACAAAATTGGG + Intergenic
985316906 4:188667646-188667668 CTCTAAAAAAATACAAAAATTGG - Intergenic
985691045 5:1312580-1312602 CTACAAAAAAATACAAAAATTGG + Intergenic
986787117 5:11124778-11124800 ATATAAAAATATACAAAACTTGG - Intronic
986876236 5:12113984-12114006 CTATACAAAAACATATAATTTGG - Intergenic
986915795 5:12618445-12618467 CTATGCAAAAAGAACAAAGTTGG - Intergenic
986925516 5:12743740-12743762 CTCTACAAAAATACAAAAATTGG + Intergenic
987252093 5:16110403-16110425 CAGTGCAAAAATGCAAAAGTAGG - Intronic
987349833 5:17011962-17011984 CTTTACAAGAATACACAAATTGG + Intergenic
987606661 5:20144398-20144420 CTATACCAAAAGAGAGAAGTTGG - Intronic
988220830 5:28345102-28345124 CTATAAAAAAATACCATAGACGG + Intergenic
988315079 5:29615273-29615295 AAAAACAAAAATACACAAGTGGG - Intergenic
988495645 5:31743338-31743360 CTACAAAAAAATACAAAGATTGG - Intronic
988518167 5:31922842-31922864 CTAACTAAAAATACAAAAATCGG - Intronic
988864049 5:35315618-35315640 AAATAAAAAAATACAAAAGTAGG + Intergenic
988980969 5:36568934-36568956 CTATACCGAAATACAATAGTTGG - Intergenic
989371548 5:40715134-40715156 CTTTCTAAAAATAAAAAAGTAGG - Exonic
989772362 5:45159877-45159899 CTAAACAAAAAGACCAAAGCTGG - Intergenic
990395492 5:55374450-55374472 CTCTACAAAAATAAAAAATTAGG - Intronic
990570723 5:57075651-57075673 CTATAAAAAAATAAAAAACCTGG + Intergenic
990697443 5:58436486-58436508 CTACAAAAAAATGCAAAAATTGG - Intergenic
991092647 5:62707936-62707958 CTATAGAAAAATACCAAGGTGGG - Intergenic
991104178 5:62825458-62825480 CTACCCAAAAAAAAAAAAGTAGG - Intergenic
991373864 5:65945201-65945223 GTATAGAAAAATACAAGACTTGG - Intronic
991591123 5:68252367-68252389 ATTTACAAAAAAAAAAAAGTGGG + Intronic
991699566 5:69304589-69304611 CTCTACTAAAACACAAAAATTGG - Intronic
991728765 5:69562411-69562433 CTCTACAAAAATATAAAACATGG + Intronic
991805195 5:70417560-70417582 CTCTACAAAAATATAAAACATGG + Intergenic
991866189 5:71065462-71065484 CTCTACAAAAATATAAAACATGG - Intronic
991937900 5:71820016-71820038 ATAGACAAAAAGAAAAAAGTGGG + Intergenic
992290481 5:75274325-75274347 CTTTACCAAAATACGAAAGTTGG - Intergenic
992505534 5:77383922-77383944 CTAAACAAAAATAACAAAGCTGG - Intronic
992604929 5:78445996-78446018 TTATTCAGAAATAGAAAAGTTGG + Intronic
992782397 5:80140151-80140173 CTCTACAAAAAAATAAAAATCGG + Exonic
992797955 5:80270093-80270115 CTCTACTAAAATACAAAAATTGG + Intergenic
993217326 5:85042856-85042878 CTAGGCAAAAAGACAAAAGATGG - Intergenic
993316629 5:86415186-86415208 GTATACAATAATACCAAAGCAGG + Intergenic
993632978 5:90309944-90309966 CTACAAAAAAATACCAAAATTGG + Intergenic
994772151 5:103996847-103996869 CTGTACCAAATTACAAAAATGGG - Intergenic
994861869 5:105206762-105206784 ATATACAGAAATACAAAAAAAGG + Intergenic
994985970 5:106933968-106933990 CTATACTAAAAGATAAAATTCGG - Intergenic
995088895 5:108148595-108148617 CTATATAAAGAAACAAAAATAGG + Intronic
995229730 5:109745781-109745803 CTCTACAAAATTATAAAAATTGG - Intronic
995432157 5:112092243-112092265 CAATACAAAAAGCAAAAAGTTGG + Intergenic
996733667 5:126739205-126739227 CCATAAAAAAATACAAAAATTGG - Intergenic
996740461 5:126794098-126794120 AAATACAAAAATACAAAAGTTGG - Intronic
996940850 5:129003668-129003690 CTCTACAAAAGTAAAAAATTAGG + Intronic
997278472 5:132620199-132620221 TTAGACAAAAATATAGAAGTAGG - Intronic
997904963 5:137807419-137807441 CCCTAAAAAAATACAGAAGTTGG + Intergenic
998473455 5:142401228-142401250 CTAAAAAAAAAAAAAAAAGTGGG + Intergenic
998608554 5:143662815-143662837 CTATATAAATATACCAAAGTAGG - Intergenic
998990342 5:147808471-147808493 CTCTACTAAAAAACAAAAATTGG + Intergenic
999207663 5:149861482-149861504 CTACAAAAAAATACAAAAATTGG + Intronic
999536925 5:152528105-152528127 ATCTACAAAAAAAAAAAAGTAGG - Intergenic
1000269946 5:159674500-159674522 CTCTATAAAAATACAGAAGTTGG + Intergenic
1000842756 5:166242298-166242320 TTATCCACAAATAGAAAAGTAGG + Intergenic
1001458228 5:171884304-171884326 GCAAACAAAAATATAAAAGTGGG - Intronic
1001463205 5:171937251-171937273 AAATACAAAAAAAGAAAAGTGGG + Intronic
1001497653 5:172201073-172201095 AAATGCAAAAATACAAAAATTGG + Intronic
1001593191 5:172880489-172880511 CTACAAAAAAATACAAAAATTGG - Intronic
1001770142 5:174289178-174289200 CTTTATAAAAAGACAAAATTGGG + Intergenic
1001830251 5:174780682-174780704 GAATAAAAAAAAACAAAAGTTGG - Intergenic
1002135092 5:177102594-177102616 CTACAAAAAAATACAAAAATTGG + Intergenic
1003081539 6:3025333-3025355 CTACTAAAAAATACAAAAATTGG + Intergenic
1003298071 6:4851950-4851972 CTATAGAAATAAATAAAAGTAGG - Intronic
1003448577 6:6209130-6209152 CAATTCAACAATACAAAAGTAGG + Intronic
1003678193 6:8226460-8226482 TTATAAAAAAAGAAAAAAGTTGG - Intergenic
1003789836 6:9533676-9533698 CAATATCAAAAAACAAAAGTAGG + Intergenic
1004155163 6:13161143-13161165 CTGCACAAAAATACAAAAATTGG - Intronic
1004503427 6:16228687-16228709 CTATATAAAGTTACAAAGGTGGG - Intergenic
1004677631 6:17859300-17859322 GCATATAAAAATACAAGAGTAGG + Intronic
1004798896 6:19122984-19123006 CTATAAAAATATACAAATGGTGG + Intergenic
1004970707 6:20907254-20907276 CTCTATAAAAATATAAAATTTGG + Intronic
1005292519 6:24393612-24393634 CAAAACAAAAAAACAACAGTTGG - Intergenic
1005396754 6:25390484-25390506 CTACAAAAAAATATAAAAATAGG - Intronic
1005453211 6:25993550-25993572 CTCTACTAAAATACAAAAATTGG - Intergenic
1005604262 6:27460147-27460169 CTATTCATAAAAAGAAAAGTAGG - Intronic
1005617403 6:27587732-27587754 CTACTAAAAAATACAAAAATTGG + Intergenic
1006127371 6:31848139-31848161 CTCTACAAAATTAAAAAATTAGG + Intergenic
1006148791 6:31975499-31975521 CCCTATAAAAATACAAAATTAGG - Intronic
1006481027 6:34294284-34294306 CTACAAAAAAATACAAAAATTGG - Intronic
1006491837 6:34394251-34394273 CTACAAAAACATACAAAAGTTGG - Intronic
1006560116 6:34903821-34903843 CTATAAAAAAATTAAAAATTAGG - Intronic
1006786834 6:36673725-36673747 CTCTACTAAAATACAAACATTGG + Intergenic
1007328794 6:41087094-41087116 TTATACAAAAATAGGAAAATGGG + Intronic
1007460632 6:42016099-42016121 CTCTACTAAAATACAAAAATTGG - Intronic
1007555263 6:42760358-42760380 CTAAAAAAAAAAAAAAAAGTGGG + Intronic
1007591922 6:43026833-43026855 CTCTACTAAAATACAAAAGGAGG + Intronic
1007674923 6:43585493-43585515 GCATACAAAAAGACAAAACTTGG + Intronic
1008445261 6:51581974-51581996 CTCTATAAAAATACAAAAATTGG - Intergenic
1008555530 6:52670247-52670269 CTCTACAAAAAAAAAATAGTCGG + Intergenic
1008651238 6:53565181-53565203 ATATACAAAAATAAATAAATAGG - Intronic
1008975591 6:57422301-57422323 CTCTACAAAAATACAAAAAGTGG - Intronic
1009322450 6:62308989-62309011 CAATTCAAAAACACAAAGGTGGG - Intergenic
1009609893 6:65927826-65927848 CTACAAAAAAATAAAAAAATTGG - Intergenic
1009617265 6:66025785-66025807 ATATATAAAAATAGATAAGTAGG - Intergenic
1009621288 6:66081177-66081199 CTATGCAAAAAGAACAAAGTTGG - Intergenic
1009952010 6:70408724-70408746 TTAAACATAAAGACAAAAGTAGG + Intergenic
1010029614 6:71259457-71259479 CTACTAAAAAATACAAAAATTGG - Intergenic
1010205463 6:73318906-73318928 CTCTACTAAAATACAAAAATTGG + Intergenic
1010361529 6:75000725-75000747 CTCTACAAAAATTAAAAAATTGG + Intergenic
1010689188 6:78888950-78888972 CTACAGAAAAATACAATAATAGG + Intronic
1010848327 6:80740361-80740383 CTGAACAAAAATAACAAAGTTGG - Intergenic
1011372844 6:86657756-86657778 CTAAAAAAAAAAAAAAAAGTGGG + Intergenic
1011395771 6:86905280-86905302 CTATACAAAAATACAAAAATTGG - Intergenic
1011416815 6:87130338-87130360 CTACAAAAAAATACAAAATGTGG - Intergenic
1011656948 6:89560655-89560677 CTCTGCTAAAATACAAAAATTGG + Intronic
1011846794 6:91574463-91574485 ATATTTAAAAAAACAAAAGTGGG - Intergenic
1012056874 6:94424086-94424108 CAAAACAAACATACAAAAATCGG - Intergenic
1012133785 6:95529811-95529833 CTTCACTAAAATACAAAAATTGG + Intergenic
1012470340 6:99566129-99566151 TGATACAAAAATACAAAATTAGG - Intronic
1012498331 6:99859883-99859905 CTAAGCAAAAAGACAAAAGCTGG + Intergenic
1012502748 6:99907514-99907536 CTAAGCAAAAATAGAAAAATGGG + Intergenic
1012524428 6:100160368-100160390 TGACACAAAAATACAAAAGTTGG - Intergenic
1012606356 6:101162679-101162701 TTATACTAGAATTCAAAAGTTGG - Intergenic
1012764523 6:103349341-103349363 CTGTAAAAAAATAGAAAATTTGG - Intergenic
1012950404 6:105512209-105512231 CTCTACTAAAATACAAAATTAGG - Intergenic
1013409939 6:109875013-109875035 CTATGCACACAAACAAAAGTGGG - Intergenic
1013483104 6:110568969-110568991 CTCTACCAAAAAACAAAATTAGG - Intergenic
1013514423 6:110873196-110873218 CTCTACTAAAATACAAAAATTGG + Intronic
1013534500 6:111051584-111051606 CTACAGAAAAATAAAAAAATTGG + Intergenic
1013577121 6:111494773-111494795 CTCTACAAAAATAAAAAAACTGG - Intergenic
1013639077 6:112055754-112055776 CTCTACTAAAATACAAAAATTGG - Intronic
1013646148 6:112143448-112143470 CTCTACCAAAATACAAAAATTGG - Intronic
1013697529 6:112721524-112721546 CTATACAAAAAGAAAAGAGTAGG - Intergenic
1013728976 6:113140064-113140086 CTATTAAAAAATAAAAAATTGGG + Intergenic
1013759371 6:113499000-113499022 ATATACAAAAAGCAAAAAGTAGG + Intergenic
1014170142 6:118269496-118269518 CTCTATAAAAATATTAAAGTAGG + Intronic
1014347359 6:120290137-120290159 CTATACAAAGAGACAAACATTGG + Intergenic
1014940051 6:127427668-127427690 GTACAAAAAAATACAAAAATTGG - Intergenic
1015036016 6:128655546-128655568 CCATACAAACATAAAAAAGCAGG - Intergenic
1015179207 6:130344108-130344130 CTATAATAAAATAAATAAGTTGG - Intronic
1015772437 6:136783137-136783159 CTACATAAAAATACAAAAATTGG + Intronic
1015913867 6:138195166-138195188 CTACTAAAAAATACAAAAATTGG - Intronic
1015955960 6:138598290-138598312 CTCTACAAAAATACAAAAATTGG + Intronic
1015967773 6:138712061-138712083 CTAAAAAAAAAGAGAAAAGTAGG - Intergenic
1016210224 6:141523132-141523154 CAATACAAAGTTTCAAAAGTTGG + Intergenic
1016217942 6:141625913-141625935 ACATACAAACAAACAAAAGTGGG + Intergenic
1016451001 6:144182196-144182218 TTATACAAAAATATAGAAGTGGG - Intronic
1016545072 6:145212598-145212620 CTACTAAAAAATACAAAAATTGG + Intergenic
1016593837 6:145776255-145776277 CTAAACAAAAATAACAAAGCTGG - Intergenic
1016603650 6:145892214-145892236 ATATGCAAAAATACAATGGTGGG - Intronic
1016679300 6:146809504-146809526 CTACAAAAAAATACAGAAATTGG - Intronic
1017357480 6:153526654-153526676 CTATGCAAAAAGCCACAAGTAGG - Intergenic
1017463275 6:154671393-154671415 CTATAAAAAAATACAAAAATTGG + Intergenic
1017463297 6:154671529-154671551 CTACAAAAAAATACAAAAGTTGG + Intergenic
1017589647 6:155965049-155965071 ATATACATAAATTCAAAACTTGG + Intergenic
1017943070 6:159070074-159070096 CTACAAAAAAATATAAAAATTGG - Intergenic
1018665438 6:166132567-166132589 CTCTACAAAAATACAAAAATTGG + Intergenic
1018963930 6:168468698-168468720 CTCTACAAAAATACAAAAATTGG - Intronic
1019035258 6:169049397-169049419 TTATACAAAAAATGAAAAGTGGG - Intergenic
1019348130 7:540349-540371 CTACAGAAAAATATAAACGTGGG + Intergenic
1019765445 7:2846452-2846474 CTACTAAAAAATACAAAACTTGG + Intergenic
1019842723 7:3464355-3464377 CTTTACAAAAATTTAAAAATTGG + Intronic
1019988491 7:4675840-4675862 CTACAAAAAAATACAAAAATTGG - Intergenic
1020019677 7:4855977-4855999 GTAGAGAAAAATACAAAAGGTGG + Intronic
1020081821 7:5290361-5290383 CTCTACTAAAATACAAAAAATGG - Intronic
1020196245 7:6041673-6041695 CTACTAAAAAATACAAAAATTGG + Intronic
1020227690 7:6293085-6293107 CTACAAAAAAATACAAAAATTGG - Intergenic
1020317620 7:6917714-6917736 CTCTACTAAAAAACAAAAATTGG - Intergenic
1020425549 7:8062104-8062126 CTATACTAAAATAAAAAACTTGG + Intronic
1020506551 7:8996417-8996439 CAATACCAAAAAACAAAATTTGG + Intergenic
1020558663 7:9701319-9701341 CTAAACAAAAAGAAAAAAGCTGG + Intergenic
1020732308 7:11895992-11896014 CTATACAAAAATACATTCTTTGG - Intergenic
1020872616 7:13650812-13650834 CAACAGAAAAATACAAAACTGGG - Intergenic
1021155262 7:17202390-17202412 CAAAACAAAAATAGAAAAATGGG - Intergenic
1021406040 7:20268179-20268201 CTCTAGAAAAATACAAAAATTGG - Intergenic
1022153955 7:27640362-27640384 CTCTACAAAAATACAAAAATTGG + Intronic
1022239224 7:28492691-28492713 ATATACAAAAATACACAACATGG - Intronic
1022276033 7:28855893-28855915 CTACACAAAAATACAGTAGGAGG + Intergenic
1022664331 7:32396310-32396332 CTCTATAAAAATACAAAAATTGG + Intergenic
1022681676 7:32553927-32553949 CTATACAAAATTAAAAGTGTTGG + Intronic
1023054789 7:36282974-36282996 CTAGACAAACATAAGAAAGTGGG + Intronic
1023450063 7:40274595-40274617 TGATACAAAAATACAAAACTGGG + Exonic
1023890646 7:44389517-44389539 AAATACAAAAATACAAAATAAGG + Intronic
1024231119 7:47364446-47364468 CTCTACAAAGTTACAAAAATTGG - Intronic
1024535971 7:50434154-50434176 CTATAAAAAAATAGAAAGCTTGG - Intergenic
1024767214 7:52673978-52674000 CTAACAAAAAATACAAAAATTGG + Intergenic
1025197092 7:56941775-56941797 CTCTACTAAAATACAAAAAATGG + Intergenic
1025265251 7:57451179-57451201 CTCTACTAAAAAACAAAAGCCGG - Intronic
1025674856 7:63635162-63635184 CTCTACTAAAATACAAAAAATGG - Intergenic
1025732083 7:64116070-64116092 CTACTAAAAAACACAAAAGTTGG - Intronic
1025927803 7:65973286-65973308 CTACTGAAAAATGCAAAAGTTGG + Intronic
1026034191 7:66819313-66819335 CTATAAAAAAAAAGAAAAATAGG - Intergenic
1026333921 7:69377749-69377771 CTCTACAAAAAAATAAAAATTGG - Intergenic
1026699207 7:72624891-72624913 CTACAAAAAAGTACAAAAATTGG + Intronic
1026812040 7:73475756-73475778 CTCTACAAAAACACAAAAATTGG + Intronic
1027045772 7:74990552-74990574 CTACAAAAAAATAAAAAATTAGG + Intronic
1027279625 7:76597945-76597967 CTAAGCAAAAATAGAAAAGCTGG + Intergenic
1027490701 7:78822284-78822306 ATATACAAATATACAGCAGTAGG + Intronic
1027499996 7:78938098-78938120 CTACACAAAACAACAAAAGTCGG + Intronic
1027647783 7:80826018-80826040 CAATAAAAAAATTTAAAAGTGGG - Intronic
1027656246 7:80934198-80934220 GTATACAAATATACAAAAAGAGG - Intergenic
1027738747 7:81972151-81972173 ATAAACAAAAACACAAAAGAAGG - Intronic
1028007038 7:85586765-85586787 TTATAAAAATATACAAAAATAGG - Intergenic
1028397417 7:90386504-90386526 CTTTACTAAAATAAGAAAGTGGG - Exonic
1028733505 7:94180070-94180092 CTGTATGAAAATACACAAGTGGG + Intergenic
1028991087 7:97049615-97049637 CTAAACAAACATACAAATATGGG + Intergenic
1029042107 7:97586971-97586993 CTATAAAAAAATAGAAAAAATGG - Intergenic
1029444982 7:100606789-100606811 CTTTTCAAAAATAAAAAATTAGG + Intronic
1029683862 7:102131836-102131858 CTTTACTAAAATACAAAAATTGG - Intronic
1030090954 7:105858063-105858085 CTCTACAAAAAATAAAAAGTTGG + Intronic
1030151942 7:106415768-106415790 AGATACAAAAATCCAAAAGCAGG - Intergenic
1030204951 7:106943637-106943659 ATATACATAAATACATAAATGGG - Intergenic
1030215446 7:107040751-107040773 CTATAAAAAAATACAAAAATTGG - Intergenic
1030264745 7:107607944-107607966 CTATACAAAAGTAGAAAACATGG - Intronic
1030363168 7:108616646-108616668 CTATAAAAAAAAAAAAAAATGGG + Intergenic
1030439367 7:109567421-109567443 ATAAAGAAAAATATAAAAGTAGG - Intergenic
1030519196 7:110576161-110576183 ATATACATAAATACATAAATAGG - Intergenic
1030534762 7:110752429-110752451 GTATATATAAATAGAAAAGTTGG - Intronic
1031233689 7:119144025-119144047 CTACTAAAAAATACAAAAATAGG - Intergenic
1031389729 7:121199376-121199398 CTATAGAAAAATACAAACATAGG + Intronic
1031401827 7:121333313-121333335 AAATACAAAAACAGAAAAGTCGG + Intronic
1031715178 7:125100394-125100416 TTATATAAAATAACAAAAGTTGG - Intergenic
1031842782 7:126766428-126766450 CTATACAAAAATTAAACATTGGG + Intronic
1032021915 7:128411549-128411571 CTACTAAAAAATACAAAATTAGG + Intergenic
1032039513 7:128547610-128547632 CTCTACTAAAATACAAAAAATGG - Intergenic
1032200346 7:129817564-129817586 CTTTACAGAAATAAAAAAGATGG - Intergenic
1032259764 7:130325870-130325892 ATTTACAAAAATCAAAAAGTTGG + Intergenic
1032605273 7:133343973-133343995 AAAAACAAAAATAAAAAAGTTGG - Intronic
1032910423 7:136422802-136422824 CTACTAAAAAATACAAAAATTGG - Intergenic
1033177686 7:139140620-139140642 AAATACAAAAATACAGAAGGTGG + Intronic
1033856746 7:145571354-145571376 CAGCACAAAAAGACAAAAGTTGG - Intergenic
1033879061 7:145859167-145859189 CAATCCAAAAAGACACAAGTGGG + Intergenic
1034068525 7:148160072-148160094 CTACCAAAAAATACAAAAATTGG + Intronic
1034182448 7:149148634-149148656 CTATACACAAAAAAAAAGGTTGG - Intronic
1034521405 7:151623196-151623218 CTCTACAAAAATACAAAAATTGG + Intronic
1034530277 7:151692020-151692042 CTACAAAAAATTAAAAAAGTTGG + Intronic
1034586320 7:152096548-152096570 CTCTACTAAAATACAAAATTAGG + Intronic
1034631195 7:152531798-152531820 CTACAAAAAAATACATAAATTGG + Intergenic
1034653244 7:152708899-152708921 CTACCAAAAAATACAAAAATTGG - Intergenic
1034915717 7:155037107-155037129 CTATTTAAAAATATACAAGTAGG - Intergenic
1035133820 7:156679997-156680019 ATATACAAAATTTCAAAACTTGG - Exonic
1035144160 7:156796443-156796465 CAATACAAATAAACAAAGGTTGG + Exonic
1035203597 7:157281018-157281040 CTCCACAAAAATAAAAAAATTGG + Intergenic
1035443993 7:158927235-158927257 CTACAAAAAAATTCAAAAATTGG + Intronic
1036427969 8:8663929-8663951 CTGTACAGAAATACAAAACTTGG - Intergenic
1036815989 8:11903159-11903181 CTCTGCAAAAATTCAAAACTTGG - Intergenic
1036917172 8:12815187-12815209 CTCTACAAAAATACAAAAATTGG + Intergenic
1037080898 8:14784735-14784757 AAATACAAAAATACAAAATTAGG + Intronic
1037337239 8:17803285-17803307 CTAAAAAAAAAAAAAAAAGTTGG + Intergenic
1037443215 8:18938455-18938477 CTACTAAAAAATACAAAAATTGG + Intronic
1037491846 8:19403614-19403636 CTACAAAAAAATACATAATTAGG - Intergenic
1037493648 8:19419010-19419032 CTCTACTAAAATAAAAAAATTGG - Intronic
1037943186 8:22970095-22970117 CTATAACAAAATACACAGGTGGG + Intronic
1038072428 8:24031909-24031931 ATATACACAAATACATAAATAGG - Intergenic
1039102274 8:33953418-33953440 CTAAGCAAAAATAAAAAAGCTGG - Intergenic
1039263863 8:35803564-35803586 CTTTATTAAAATACAAAAATTGG + Intergenic
1039603300 8:38860097-38860119 CTCTACTAAAATACAAAAATTGG - Intergenic
1039743388 8:40402310-40402332 CTTTACAGAAATGCAAAAGAAGG - Intergenic
1040429926 8:47329370-47329392 CTACAAAAAAATACAAAAATTGG - Intronic
1040491556 8:47927965-47927987 CTATTCTCAAATACAAAAATTGG + Intronic
1040576437 8:48655589-48655611 CTCTACTAAAATACAAAAATTGG - Intergenic
1040804133 8:51375933-51375955 ATTTACAAAATTAGAAAAGTAGG + Intronic
1041276257 8:56161276-56161298 CAATAAAAATATACAAAATTCGG + Exonic
1041533337 8:58896507-58896529 CTCTACTAAAATACAAAAATTGG + Intronic
1041577645 8:59418253-59418275 CTAAACAAAAAGAAAAAAGCTGG - Intergenic
1041655258 8:60343115-60343137 CTATACAAAAAGAACAAAGCTGG + Intergenic
1042312915 8:67396432-67396454 CTATAAAGAAATACCCAAGTCGG - Intergenic
1042608855 8:70576325-70576347 CAACACAAAAAGACAAATGTTGG + Intronic
1042919214 8:73905970-73905992 CTCTACACAAATACAAAATTTGG + Intergenic
1043085869 8:75831734-75831756 TTATACAAAAATACATCAGAAGG - Intergenic
1043108296 8:76144092-76144114 CTTTACAAAAATGAAAAAGAAGG + Intergenic
1043243172 8:77962559-77962581 ATTTGCAAACATACAAAAGTTGG + Intergenic
1043256463 8:78143949-78143971 CTATACACAAATACTAACTTTGG + Intergenic
1043418176 8:80072936-80072958 CTACTAAAAAATACAAAAATTGG + Intronic
1043520600 8:81041274-81041296 CTATACAAAACCACAATAGAGGG + Intronic
1044414350 8:91919226-91919248 CTGTACAAATATTCTAAAGTGGG - Intergenic
1044420989 8:91995619-91995641 CTCTACAAAAATCAAAAAGTTGG + Intronic
1044574126 8:93750069-93750091 ATTTACATACATACAAAAGTGGG - Intergenic
1044813124 8:96084115-96084137 CTACAAAAAAATACAAAAATTGG + Intergenic
1044966232 8:97576411-97576433 CCACAAAAAAATACAAAAGCTGG + Intergenic
1045318837 8:101066052-101066074 CTACTAAAAAATACAAAACTTGG + Intergenic
1045444785 8:102249442-102249464 CTTTACAAAAATACAAAAATTGG + Intergenic
1046177266 8:110594055-110594077 CTCTTCAAAAATCTAAAAGTAGG - Intergenic
1046424849 8:114033420-114033442 GTTTACTAAAATACAAAAGCAGG + Intergenic
1046622612 8:116544234-116544256 CTCTACAAAAATAAAAAATTAGG + Intergenic
1046916230 8:119680920-119680942 CTCTACCAAAATAGAAAAATTGG + Intergenic
1047165276 8:122431753-122431775 CTATAAAGAAATACCAATGTTGG - Intergenic
1047624705 8:126644595-126644617 CTACAGAAAAATACCAAAGACGG - Intergenic
1049059810 8:140267830-140267852 CTACTAAAAAATACAAAAATTGG - Intronic
1049091307 8:140516311-140516333 CTACTAAAAAATACAAAAATAGG - Exonic
1049459087 8:142714000-142714022 CTCTACAAAAATACAAAAATAGG + Intergenic
1049872481 8:144991268-144991290 CTTTAAAAAAAAAAAAAAGTAGG - Intergenic
1049991129 9:992885-992907 AGAGACAAAAATACAAAAGCTGG - Intergenic
1050448698 9:5756103-5756125 CTAAAAAAAAAAAAAAAAGTCGG + Intronic
1050539875 9:6660737-6660759 CTCTACAAAAAAGAAAAAGTTGG + Intergenic
1050547593 9:6721886-6721908 CTCTACAAAAATTAAAAAATGGG - Intronic
1050690344 9:8220647-8220669 CTATACAATAATACAATCTTGGG + Intergenic
1051085749 9:13346971-13346993 CCATAAATAAATACAAATGTTGG + Intergenic
1051276671 9:15405713-15405735 CTATACAACTATAAAAAAATGGG + Intergenic
1051466430 9:17383350-17383372 CTCTACCAAAAAAAAAAAGTTGG + Intronic
1051576250 9:18619147-18619169 ATAAACAGAAATACAAAAATGGG - Intronic
1051621930 9:19059454-19059476 ATATACAAAAACACACAAGGTGG + Intronic
1051993529 9:23183987-23184009 CTATACCAAAAAACAAATCTAGG - Intergenic
1052062552 9:23978709-23978731 TTACAAAAAAATACAAAAATTGG - Intergenic
1052119977 9:24702595-24702617 CTATACAAACATAAAATAATTGG - Intergenic
1052843996 9:33318640-33318662 CTATAAGAAAATACAAAATGCGG - Intronic
1052922933 9:33987108-33987130 ATACAAAAAAATACAAAAATTGG + Intronic
1052946037 9:34168947-34168969 CTACAAAAAAATACAAAATTAGG - Intergenic
1053248274 9:36553226-36553248 CTCTACTAAAATACAAACATTGG + Intergenic
1053266812 9:36721201-36721223 CTACAAAAAAATACAAAATTAGG + Intergenic
1054755773 9:68956302-68956324 CTCTAGAAAAATACAAAAATTGG + Intronic
1054777656 9:69137526-69137548 CAACAAAAAAATACAAAAATTGG - Intronic
1055008414 9:71536015-71536037 CTATAAAAAAATATAATAATAGG + Intergenic
1055308424 9:74953269-74953291 CTCTACAAAAAATCAAAAATAGG + Intergenic
1055314330 9:75018799-75018821 CTCTACTAAAATATAAAAATTGG + Intronic
1055624014 9:78154463-78154485 CTAAGCAAAAATAACAAAGTTGG + Intergenic
1056222451 9:84463643-84463665 GTATACAGATATACAAAAGGGGG - Intergenic
1056342801 9:85654539-85654561 CTTTAAAAACATACATAAGTTGG + Intronic
1056702507 9:88922566-88922588 TTATACTAAAATAATAAAGTGGG + Intergenic
1056924790 9:90825018-90825040 CTAGATCAATATACAAAAGTCGG + Intronic
1056960293 9:91117252-91117274 CTTAAAAAAAATACAAAAATTGG - Intergenic
1057117939 9:92543305-92543327 CTATCAAAAAATACAAAAATTGG + Intronic
1058037618 9:100270442-100270464 CTCTACAAAAATACAAAAACTGG + Intronic
1058093760 9:100836335-100836357 CTACTAAAAAATACAAAAATTGG - Intergenic
1058319647 9:103613044-103613066 CAAAACAAAAATAAACAAGTGGG - Intergenic
1058349542 9:104005717-104005739 CTACACTAAAATAGAAAAGATGG - Intergenic
1059046632 9:110875817-110875839 CAATATAAAAATACTGAAGTTGG + Intronic
1059108090 9:111528977-111528999 CTCTACAAAAATACAAACTCAGG + Intronic
1059197658 9:112385791-112385813 CTACTAAAAAATACAAAAATTGG - Intronic
1059816566 9:117923258-117923280 TAAAAAAAAAATACAAAAGTTGG - Intergenic
1060253372 9:122003954-122003976 AAATACAAAAATACAAAAAGTGG + Intronic
1060372555 9:123088214-123088236 CTACAAAAAAATATAAAAATTGG - Intronic
1060387787 9:123248616-123248638 CTATACAAACCTATAAAAATAGG + Intronic
1060502889 9:124176010-124176032 CTAATAAAAAATACAAAAATTGG - Intergenic
1061758860 9:132835821-132835843 CTACAAAAAAATAAAAAATTAGG + Intronic
1061810428 9:133159496-133159518 ACATACAAGAATACAAAAGCAGG + Intronic
1062317024 9:135972403-135972425 CTAAAAAAAAAAAAAAAAGTAGG - Intergenic
1062400185 9:136369118-136369140 CTACAAAAAAATGCAAAAATTGG - Intronic
1185851973 X:3497833-3497855 TTCTAAAAAAATACAAAAATTGG - Intergenic
1186051100 X:5596663-5596685 GTCTACAAAAAGGCAAAAGTAGG + Intergenic
1186153638 X:6703298-6703320 CTACAAAAAAATTCAAAAGTTGG - Intergenic
1186550164 X:10496012-10496034 CTTTTTAAAAATATAAAAGTAGG - Intronic
1186650181 X:11551027-11551049 AAATACAAATGTACAAAAGTAGG + Intronic
1187166234 X:16806615-16806637 CTACTAAAAAATACAAAAATTGG + Intronic
1187339672 X:18409850-18409872 CTTAAAAAAAATACAAAAATTGG - Intergenic
1187358909 X:18606013-18606035 CTCTACTAAAATACAAAAATTGG + Intronic
1187584635 X:20646677-20646699 CTATACAATGATACAAAGGAAGG + Intergenic
1187599268 X:20808636-20808658 ATATACTAAAATATAAAAGGTGG - Intergenic
1187711738 X:22061243-22061265 CCCTACAAAAATTGAAAAGTTGG + Intronic
1187839516 X:23472393-23472415 CTAAACAAAAATAACAAAGCTGG - Intergenic
1187963857 X:24591587-24591609 CTCTACTAAAATACAAAAATTGG - Intronic
1188372231 X:29382860-29382882 TTCTATAAAAATGCAAAAGTTGG + Intronic
1188431845 X:30112124-30112146 CTATAAAAAAGAACAAAATTGGG - Intergenic
1188740640 X:33775416-33775438 CTATATAAAAATAAAATAATGGG - Intergenic
1188779015 X:34256974-34256996 GTATACAAAAATAAACAGGTGGG + Intergenic
1188784080 X:34322712-34322734 CAAAACAAAAATAGACAAGTGGG + Intergenic
1188810462 X:34648237-34648259 CTAAACAAAAAGAACAAAGTTGG + Intronic
1188903572 X:35763856-35763878 CTACTAAAAAATACAAAAGTTGG + Intergenic
1188906299 X:35796142-35796164 CTAAAAAAAAATACAAAATTAGG - Intergenic
1189467396 X:41287714-41287736 CTACAAAAAAATACAAAAATTGG + Intergenic
1189659432 X:43280828-43280850 ATAAACAAAAATTGAAAAGTGGG - Intergenic
1189946211 X:46182080-46182102 CTCTAATAAAATACAAAATTAGG + Intergenic
1190121682 X:47665457-47665479 CTCCACAAAAATACAAAAATTGG + Intergenic
1190383704 X:49863780-49863802 TTATATAAAAATACAAAAGCAGG - Intergenic
1190514699 X:51211209-51211231 CAAAACAAAAATAAACAAGTGGG + Intergenic
1191971844 X:66825433-66825455 CCCTACAAAAATACAAAAATTGG + Intergenic
1192118839 X:68435813-68435835 CTACAAAAAAATACAAAAATTGG - Intergenic
1192638584 X:72843471-72843493 CTATTAAAAAATACAAAAAATGG + Intronic
1192643130 X:72877337-72877359 CTATTAAAAAATACAAAAAATGG - Intronic
1192720035 X:73685407-73685429 CTTTACATAAATGCCAAAGTGGG - Intronic
1193784563 X:85744035-85744057 CTAAACAAAAATAACAAAGCTGG + Intergenic
1193854978 X:86589226-86589248 GTATTCAAAAAACCAAAAGTTGG - Intronic
1194425450 X:93731965-93731987 AAAAAAAAAAATACAAAAGTTGG + Intergenic
1194527177 X:94990913-94990935 CAAAACAAAAATAGAAAAATTGG + Intergenic
1194912669 X:99666166-99666188 CTAAGCAAAAAGACAAAACTGGG - Intergenic
1195054262 X:101128031-101128053 CTATTAAAAAATACAAAAATTGG + Intronic
1195086981 X:101422179-101422201 CTACTAAAAAATACAAAAATTGG - Intronic
1195096767 X:101509567-101509589 CTACAAAAAAATACAAAAAGAGG - Intronic
1195165986 X:102220993-102221015 CTTTAAAAAAATATAATAGTAGG - Intronic
1195192873 X:102466095-102466117 CTTTAAAAAAATATAATAGTAGG + Intronic
1195213685 X:102675553-102675575 CTAAGCAAAAAGAAAAAAGTTGG - Intergenic
1195243512 X:102976454-102976476 TTATACAAAAAAGCAGAAGTTGG - Intergenic
1195400785 X:104458866-104458888 CAAAACAAAAAACCAAAAGTAGG - Intergenic
1195568675 X:106375091-106375113 CTAAGCAAAAATAAAAAAGCTGG + Intergenic
1195663793 X:107409412-107409434 CAAAACAAAAATAGAAAAATAGG - Intergenic
1196468419 X:115996029-115996051 CTACACAAAAAGAACAAAGTTGG - Intergenic
1196721759 X:118860892-118860914 CTCTACTAAAATACAAAAATCGG + Intergenic
1196825894 X:119739961-119739983 CAATACAAAAATACAACCGACGG + Intergenic
1197107159 X:122730429-122730451 CTAAGCAAAAATAAAAAAGCTGG + Intergenic
1197199846 X:123738859-123738881 CTTTAAAAAAAAACAAATGTCGG + Intergenic
1197222368 X:123926320-123926342 CTACTAAAAAATACAAAAATTGG - Intergenic
1197371567 X:125633009-125633031 CTAAGCAAAAATACAAAATTTGG + Intergenic
1197537071 X:127703449-127703471 CTATATTAAAGTACAAATGTGGG - Intergenic
1197931525 X:131701044-131701066 CTACTAAAAAATACAAAAATAGG + Intergenic
1198127348 X:133658932-133658954 ATCTACAAACATACAAAACTGGG + Intronic
1198794317 X:140379333-140379355 CTACTAAAAAATACAAAAATTGG + Intergenic
1199164786 X:144658765-144658787 ATATACACAAGTAGAAAAGTGGG + Intergenic
1199210966 X:145209881-145209903 CTACCAAAAAATACAAAAGTTGG + Intergenic
1199381199 X:147174427-147174449 CTCTACAAAAATAAATAAATAGG - Intergenic
1199452312 X:147990455-147990477 CAATATAAAAATACAAAAACAGG - Intronic
1199652904 X:149965207-149965229 CTATACCAAAACATAAAATTGGG - Intergenic
1200160135 X:154002892-154002914 CTCTACTAAAATACAAAAATTGG + Intergenic
1200484581 Y:3751564-3751586 CTATACAAATATAAAAAACAAGG + Intergenic
1200941943 Y:8792820-8792842 CTAAACAAAAAGAGCAAAGTCGG + Intergenic
1201061164 Y:10048034-10048056 CTAAAAAAAAAAAAAAAAGTTGG - Intergenic
1201395690 Y:13545307-13545329 CTATACAAAAAGAGCAAAGGTGG + Intergenic
1201420596 Y:13794533-13794555 CTACTAAAAAATACAAAAATTGG - Intergenic
1201492127 Y:14553471-14553493 CTAAGCAAAAATAACAAAGTTGG + Intronic
1201610004 Y:15830565-15830587 TTGTACAAAAGTAAAAAAGTGGG - Intergenic
1202012012 Y:20352063-20352085 CTGGACAAAAAGACAAAACTCGG + Intergenic
1202187680 Y:22204853-22204875 ATATAAATAGATACAAAAGTAGG + Intergenic
1202203680 Y:22381543-22381565 ATATAAATAGATACAAAAGTAGG - Intronic
1202364184 Y:24144625-24144647 CACTAAAAAAATACAAAAGTTGG - Intergenic
1202506596 Y:25525497-25525519 CACTAAAAAAATACAAAAGTTGG + Intergenic