ID: 1129449791

View in Genome Browser
Species Human (GRCh38)
Location 15:75644775-75644797
Sequence ACAAAAATACAAAAGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139639
Summary {0: 2, 1: 60, 2: 1971, 3: 16978, 4: 120628}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129449785_1129449791 6 Left 1129449785 15:75644746-75644768 CCTGGGCAACATAGTGAAAAGCC 0: 2
1: 54
2: 1800
3: 27460
4: 154767
Right 1129449791 15:75644775-75644797 ACAAAAATACAAAAGTTGGCTGG 0: 2
1: 60
2: 1971
3: 16978
4: 120628
1129449782_1129449791 24 Left 1129449782 15:75644728-75644750 CCAGGAGTTTGAGATCAGCCTGG 0: 1506
1: 22882
2: 43462
3: 59071
4: 50229
Right 1129449791 15:75644775-75644797 ACAAAAATACAAAAGTTGGCTGG 0: 2
1: 60
2: 1971
3: 16978
4: 120628
1129449781_1129449791 25 Left 1129449781 15:75644727-75644749 CCCAGGAGTTTGAGATCAGCCTG 0: 884
1: 12151
2: 22105
3: 30653
4: 26485
Right 1129449791 15:75644775-75644797 ACAAAAATACAAAAGTTGGCTGG 0: 2
1: 60
2: 1971
3: 16978
4: 120628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129449791 Original CRISPR ACAAAAATACAAAAGTTGGC TGG Intronic
Too many off-targets to display for this crispr