ID: 1129449791 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:75644775-75644797 |
Sequence | ACAAAAATACAAAAGTTGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 139639 | |||
Summary | {0: 2, 1: 60, 2: 1971, 3: 16978, 4: 120628} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129449785_1129449791 | 6 | Left | 1129449785 | 15:75644746-75644768 | CCTGGGCAACATAGTGAAAAGCC | 0: 2 1: 54 2: 1800 3: 27460 4: 154767 |
||
Right | 1129449791 | 15:75644775-75644797 | ACAAAAATACAAAAGTTGGCTGG | 0: 2 1: 60 2: 1971 3: 16978 4: 120628 |
||||
1129449782_1129449791 | 24 | Left | 1129449782 | 15:75644728-75644750 | CCAGGAGTTTGAGATCAGCCTGG | 0: 1506 1: 22882 2: 43462 3: 59071 4: 50229 |
||
Right | 1129449791 | 15:75644775-75644797 | ACAAAAATACAAAAGTTGGCTGG | 0: 2 1: 60 2: 1971 3: 16978 4: 120628 |
||||
1129449781_1129449791 | 25 | Left | 1129449781 | 15:75644727-75644749 | CCCAGGAGTTTGAGATCAGCCTG | 0: 884 1: 12151 2: 22105 3: 30653 4: 26485 |
||
Right | 1129449791 | 15:75644775-75644797 | ACAAAAATACAAAAGTTGGCTGG | 0: 2 1: 60 2: 1971 3: 16978 4: 120628 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129449791 | Original CRISPR | ACAAAAATACAAAAGTTGGC TGG | Intronic | ||
Too many off-targets to display for this crispr |