ID: 1129450450

View in Genome Browser
Species Human (GRCh38)
Location 15:75648330-75648352
Sequence CCCTCTCCCCGCCCCAGAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2910
Summary {0: 1, 1: 0, 2: 12, 3: 178, 4: 2719}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129450450_1129450466 30 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450466 15:75648383-75648405 AGCCGGGGTCGAAGAGTTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 92
1129450450_1129450454 -7 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450454 15:75648346-75648368 GAGAGGGCGCCCGAGCCGGCGGG 0: 1
1: 0
2: 2
3: 9
4: 219
1129450450_1129450455 -6 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450455 15:75648347-75648369 AGAGGGCGCCCGAGCCGGCGGGG 0: 1
1: 0
2: 1
3: 20
4: 117
1129450450_1129450465 27 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450465 15:75648380-75648402 CGCAGCCGGGGTCGAAGAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 50
1129450450_1129450457 1 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450457 15:75648354-75648376 GCCCGAGCCGGCGGGGGCTCCGG 0: 1
1: 0
2: 2
3: 27
4: 278
1129450450_1129450453 -8 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450453 15:75648345-75648367 GGAGAGGGCGCCCGAGCCGGCGG 0: 1
1: 0
2: 0
3: 24
4: 257
1129450450_1129450463 15 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450463 15:75648368-75648390 GGGCTCCGGCTGCGCAGCCGGGG 0: 1
1: 0
2: 2
3: 33
4: 273
1129450450_1129450461 13 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450461 15:75648366-75648388 GGGGGCTCCGGCTGCGCAGCCGG 0: 1
1: 0
2: 1
3: 31
4: 266
1129450450_1129450456 -5 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450456 15:75648348-75648370 GAGGGCGCCCGAGCCGGCGGGGG 0: 1
1: 0
2: 4
3: 28
4: 303
1129450450_1129450462 14 Left 1129450450 15:75648330-75648352 CCACTTCTGGGGCGGGGAGAGGG 0: 1
1: 0
2: 12
3: 178
4: 2719
Right 1129450462 15:75648367-75648389 GGGGCTCCGGCTGCGCAGCCGGG 0: 1
1: 0
2: 2
3: 31
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129450450 Original CRISPR CCCTCTCCCCGCCCCAGAAG TGG (reversed) Exonic
Too many off-targets to display for this crispr