ID: 1129451166

View in Genome Browser
Species Human (GRCh38)
Location 15:75652126-75652148
Sequence ACTAAGGCCCAGAGGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 9, 3: 83, 4: 603}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129451166_1129451177 24 Left 1129451166 15:75652126-75652148 CCTTTGCCCCTCTGGGCCTTAGT 0: 1
1: 0
2: 9
3: 83
4: 603
Right 1129451177 15:75652173-75652195 TGGGGTCCCAGTGAGCCATCAGG 0: 1
1: 0
2: 1
3: 14
4: 226
1129451166_1129451176 6 Left 1129451166 15:75652126-75652148 CCTTTGCCCCTCTGGGCCTTAGT 0: 1
1: 0
2: 9
3: 83
4: 603
Right 1129451176 15:75652155-75652177 ATCTGTAAAACAAGGGAATGGGG 0: 1
1: 0
2: 5
3: 36
4: 383
1129451166_1129451174 4 Left 1129451166 15:75652126-75652148 CCTTTGCCCCTCTGGGCCTTAGT 0: 1
1: 0
2: 9
3: 83
4: 603
Right 1129451174 15:75652153-75652175 TGATCTGTAAAACAAGGGAATGG 0: 1
1: 1
2: 1
3: 40
4: 366
1129451166_1129451171 -2 Left 1129451166 15:75652126-75652148 CCTTTGCCCCTCTGGGCCTTAGT 0: 1
1: 0
2: 9
3: 83
4: 603
Right 1129451171 15:75652147-75652169 GTTTCCTGATCTGTAAAACAAGG 0: 1
1: 72
2: 565
3: 2336
4: 6841
1129451166_1129451175 5 Left 1129451166 15:75652126-75652148 CCTTTGCCCCTCTGGGCCTTAGT 0: 1
1: 0
2: 9
3: 83
4: 603
Right 1129451175 15:75652154-75652176 GATCTGTAAAACAAGGGAATGGG 0: 1
1: 0
2: 4
3: 49
4: 359
1129451166_1129451172 -1 Left 1129451166 15:75652126-75652148 CCTTTGCCCCTCTGGGCCTTAGT 0: 1
1: 0
2: 9
3: 83
4: 603
Right 1129451172 15:75652148-75652170 TTTCCTGATCTGTAAAACAAGGG 0: 1
1: 17
2: 126
3: 564
4: 2157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129451166 Original CRISPR ACTAAGGCCCAGAGGGGCAA AGG (reversed) Intronic
901154041 1:7123649-7123671 ACCAGGGCTCAGAGGGGCCAAGG - Intronic
901671996 1:10861565-10861587 ACTGAGGCCCAGAGAGGATAAGG - Intergenic
902069496 1:13722364-13722386 AGAAAGGCCCAGAGTAGCAAGGG + Intronic
902250607 1:15152629-15152651 TCTAAGGCTCAGAGAGGGAATGG + Exonic
902338654 1:15768393-15768415 ACCAAGGCCCAGGGAAGCAAGGG - Intronic
902382450 1:16058960-16058982 ACAGAGGCCCAGAGGAGCACTGG - Intronic
902566312 1:17314013-17314035 ACTGAGGCTCAGAGAGGTAAGGG - Intronic
902622828 1:17660354-17660376 ACTGAGGATTAGAGGGGCAAAGG - Intronic
902693567 1:18125794-18125816 ACTAAGACCCAGAAGAGTAATGG + Intronic
902735071 1:18395162-18395184 ACTGAGGCCCAGAGGGAGAGAGG + Intergenic
902763824 1:18601682-18601704 ACTGAGGCCCAGAGGGGTGATGG - Intergenic
902822357 1:18951059-18951081 ACCAAGGCCCAGAGGGGGGCTGG - Intronic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
903016400 1:20364914-20364936 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
903022050 1:20401472-20401494 ACTGAGGCCCAGAGAGGGAAAGG + Intergenic
903169976 1:21546749-21546771 ACAGAGGCTCAGAGGTGCAATGG - Intronic
903240284 1:21978233-21978255 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903244033 1:22002867-22002889 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903321405 1:22545521-22545543 ACTGAGGCCCAGAAGAGAAAGGG - Intergenic
903473316 1:23602521-23602543 ACTGAGGCTCAGAGAGGGAAAGG - Intronic
903575968 1:24339989-24340011 ACTTAGGCTCAGAGGGACTAAGG - Intronic
903677551 1:25073923-25073945 ACTGAGGCCCAGAGAGGGAACGG - Intergenic
903737709 1:25540913-25540935 CCTAAGGCCCAGAGAGGGACAGG - Intergenic
903771468 1:25767035-25767057 ACCAAGGCCCAGAGTGGGCAGGG + Intronic
904265507 1:29316426-29316448 ACTGAGGCTCAGAGAGGTAAAGG - Intronic
904292923 1:29499222-29499244 ACTGAGGCTCAGAGAGGCCAAGG - Intergenic
904334045 1:29785533-29785555 ACTGAGGCTCAGAGAGGCCAAGG - Intergenic
904372272 1:30057295-30057317 ACTGAGGCCCTGAGAGGCAAAGG + Intergenic
904476778 1:30770221-30770243 ACTGAGGCCCAGAGGTGGCAGGG - Intergenic
904626123 1:31804261-31804283 ACTAAGGCACATAGAGGCACAGG + Intronic
904673337 1:32181898-32181920 ACTAAGACCCAGAGAGGAGAAGG - Intronic
904775616 1:32904373-32904395 ATTGAGGCCCAGAGAGGTAAAGG + Intergenic
904956206 1:34285986-34286008 ACTGAGGCACAGAAAGGCAAAGG - Intergenic
905213283 1:36389178-36389200 ACTGAGGCTCAGAGAGGGAAAGG - Intergenic
905360741 1:37418496-37418518 ACTGAGGCTCAGAGAGGTAACGG + Intergenic
905405705 1:37731070-37731092 TCTAAGGCCTAGTGGGGAAAGGG + Intronic
905869774 1:41396541-41396563 ACTAAGGCACAGAGGGCTTAAGG + Intergenic
906084791 1:43122254-43122276 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
906193494 1:43914300-43914322 ACTAAGGCCCAGAATGGTGAGGG - Intronic
906595493 1:47072762-47072784 CCTAAGTCCTATAGGGGCAATGG + Intronic
906611279 1:47205422-47205444 ACTAAAACCCAAGGGGGCAAGGG - Intergenic
906667018 1:47629023-47629045 ACTGAGGCCCAGAGGAGAGAAGG + Intergenic
906711149 1:47930808-47930830 ACTGAGGCCCAGAAAGGAAAAGG + Intronic
906850325 1:49242029-49242051 ATTAAGGCCACGAGGGGAAAAGG - Intronic
906944964 1:50287684-50287706 ACTAAGGCATAGAGAGTCAAGGG + Intergenic
906948783 1:50317742-50317764 ACTGAGGCCCAGAGAGGAAAAGG + Intergenic
907114650 1:51958285-51958307 ACTGAGGCCCAGAGGGTAAAGGG - Intronic
907269903 1:53284874-53284896 ACCAAGGCCCAGAGAGCAAAAGG + Intronic
907272245 1:53297970-53297992 ACTGAGGCCCAGAATGGGAAGGG - Intronic
907289520 1:53403817-53403839 ACTAAAGCCCAGAGAGGGAAAGG + Intergenic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907438290 1:54463270-54463292 ACTAACACCCAGAGAGGGAAAGG + Intergenic
907472814 1:54685451-54685473 TCTGAGGCCCAGAGGCGCCAGGG + Intronic
907481237 1:54746826-54746848 ACCAAGGCCCAGAGAGGGCAGGG - Intergenic
907517214 1:55000403-55000425 ACTGAGGCTCAGAGAGGAAAGGG - Intronic
907552442 1:55315811-55315833 ACTGAGGCCCAGAGGGCCAGGGG - Intergenic
907718662 1:56951323-56951345 ACTGAGGCCCAGAGTGGAAAAGG + Intronic
908773267 1:67615400-67615422 ACTAATGCCTGGAGGGGAAACGG + Intergenic
908923936 1:69230443-69230465 ACTAAGGGCCAGATGAGAAAGGG + Intergenic
909275164 1:73674460-73674482 ACTAAAGCACAGTGGGACAATGG + Intergenic
911301354 1:96178489-96178511 TCTAAGGCCCAGAGGAAGAAGGG - Intergenic
912544985 1:110444246-110444268 AAAAAGGCACAGAAGGGCAAGGG + Intergenic
912623133 1:111185922-111185944 ACTAAAGCCCAGTAGGGCATAGG - Intergenic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
912719923 1:112011558-112011580 ACCCAGGCTCAGAGGAGCAACGG - Intergenic
913089221 1:115465302-115465324 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
913611481 1:120513709-120513731 ACCGAGGCCCAAAGGGTCAAGGG - Intergenic
913983310 1:143543098-143543120 ACTAAGGCCCAAAGGGTCAAGGG + Intergenic
914257909 1:145975502-145975524 ACTGGGGGCCAGAGGGGCACAGG + Intronic
914579711 1:149008530-149008552 ACCGAGGCCCAAAGGGTCAAGGG + Intronic
915357814 1:155266820-155266842 GCTAAGGCCCAGAAGCTCAAAGG + Exonic
915690433 1:157683600-157683622 ACTGAGGCCTAGAGGGGCCAAGG + Intronic
915861139 1:159445705-159445727 ACTAAGGCTCAGAGGAGAGATGG + Intergenic
915904036 1:159865225-159865247 ATTAAGCCTCAGAGGGTCAAGGG - Intronic
916368047 1:164056138-164056160 ATTAAGGCTCAGAGAGGCTAAGG - Intergenic
916934089 1:169609848-169609870 AGTCAGGCCAAGAGGGGCATGGG - Intronic
917455536 1:175182706-175182728 ACTAAGGCACAGAGAGGGAAGGG - Intronic
919773883 1:201181088-201181110 ACTAATGCCCAGGGTGGAAAAGG - Intergenic
920711453 1:208299088-208299110 ACTATAGCCCAGAGAGGGAAAGG - Intergenic
920840601 1:209550675-209550697 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
921165158 1:212501893-212501915 ACCAAGGCCCAGAGAGGAGAAGG + Intergenic
921324135 1:213973813-213973835 ACTAAGGCTCAGAGAGGTACAGG + Intergenic
922154796 1:223032363-223032385 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
922216726 1:223526107-223526129 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
922420704 1:225459633-225459655 ACTAAGGCACAGAGAGGCTCAGG + Intergenic
924033903 1:239915999-239916021 ACTAAAGACCAAAGAGGCAATGG - Intergenic
924373934 1:243386193-243386215 ACTAAGGCACAGAGAAGGAAAGG + Intronic
1063040576 10:2333294-2333316 ACTACATCCCAGAGGGGGAAAGG - Intergenic
1064192825 10:13222385-13222407 AGTCAGGCCCAGATGGGCGAAGG + Intronic
1065120907 10:22529850-22529872 GCTTAGTCCCAGAGGGGCACCGG + Intergenic
1066593363 10:37020642-37020664 AGTAAGGCCTAGAGAGACAAAGG + Intergenic
1067279166 10:44858326-44858348 ACTAAAGGCCACAGGGTCAAGGG + Intergenic
1067294317 10:44966166-44966188 ATTAAGGCCCAGAGAGGAGAAGG + Intronic
1067683175 10:48452722-48452744 ACTGAGGCCAAGAGAGGCGAGGG - Intronic
1068958670 10:62844736-62844758 ACTGAGACCCAGAGAGGAAAAGG + Intronic
1069426395 10:68292173-68292195 ACTAAGGGCCAGACGAGCAGAGG - Exonic
1069546714 10:69334427-69334449 GCTGAGGCCCAGAGGGACAGAGG - Intronic
1069558334 10:69412501-69412523 ACTGAGGCCCAGAGAGGCACAGG + Intronic
1069618107 10:69819193-69819215 ACTAAGTCCCAGAAAGGGAAAGG - Intronic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069716950 10:70527193-70527215 ACTGAGGCCCAGAGAGGGAAAGG - Intronic
1069789656 10:71011545-71011567 TCTAAGGCCCAGAGAGGGGAAGG - Intergenic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1069848463 10:71389825-71389847 AGTGAGGCCCAGAGGGGGACAGG - Intergenic
1070625478 10:78047963-78047985 ACTGAGACCCAGAGGAGAAAGGG - Intronic
1070631460 10:78087955-78087977 ACTAAGGCCCAGAGATGGAAAGG - Intergenic
1070642439 10:78179481-78179503 ACCAAGACCCTCAGGGGCAAGGG + Intergenic
1070777449 10:79118107-79118129 ACTGAGGCCCTGAGAGGGAAAGG - Intronic
1070833782 10:79435691-79435713 ACTGAGGCCCACAGGGGCACAGG + Intronic
1072660494 10:97360762-97360784 ACTAAGGCCCAGAGAGGGCAAGG + Intronic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073573190 10:104598270-104598292 ACTCAGGCTCAAAGAGGCAAAGG - Intergenic
1073591838 10:104765272-104765294 AGTCAGGCCCATAAGGGCAAGGG - Intronic
1073941307 10:108701743-108701765 ACTGATGTCCAGAGGTGCAAAGG - Intergenic
1074975695 10:118579854-118579876 ACTGAGGCCCAGAGAGGGTATGG - Intergenic
1075080597 10:119381132-119381154 ACTAAGGTCCAGAGGGGAGGGGG - Intronic
1075590366 10:123686840-123686862 ATTGAGGCCCAGAGAGGGAAAGG - Intronic
1076773283 10:132678938-132678960 CCTCAGGCCCAGATGGCCAATGG + Intronic
1077525549 11:3062341-3062363 ACTGAGGCACAGAGAGGAAAAGG - Intergenic
1078197375 11:9147308-9147330 ACTAAGGGACAGAGGGACAACGG + Intronic
1078579156 11:12525496-12525518 AGAAAGGCAGAGAGGGGCAAAGG - Intronic
1079306962 11:19331906-19331928 ACTAAGGCCCAGAGAGGTTAAGG + Intergenic
1080061359 11:27960156-27960178 ACTAAGGCCCAGAGAGAAAAAGG - Intergenic
1080099257 11:28440225-28440247 ACTAAGACCTAGAGGAGAAATGG + Intergenic
1080201638 11:29678199-29678221 ACTAAGACCTACAGGGGTAAAGG - Intergenic
1080414457 11:32056269-32056291 ACTAAGACCCAGAGAGGTAAAGG + Intronic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1081607858 11:44538399-44538421 ACCAAGGCTCAGAGAGGAAATGG + Intergenic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1081702996 11:45163675-45163697 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
1081703237 11:45164906-45164928 ACTGAGGCTCAGAGAGGGAAAGG + Intronic
1081746853 11:45479393-45479415 ACTGGGGCCCAGAGAGGTAAAGG + Intergenic
1081771979 11:45655781-45655803 ACTGAGGCACAGAGAGGCCAGGG - Intronic
1082095041 11:48122961-48122983 ACGAAGACCCAGAGAGGCAGGGG - Intronic
1083299693 11:61733924-61733946 ACAGAGGCCCAGAGGAGCAAGGG + Intronic
1083307214 11:61767422-61767444 ACTGAGGCTCAGAGAGGGAAAGG + Intronic
1083446756 11:62713189-62713211 GCTAGGGCCCTTAGGGGCAAGGG - Exonic
1083855950 11:65393179-65393201 ACTGGGGCCCAGAGGCCCAAGGG - Intronic
1084033954 11:66496844-66496866 ACAGAGGCCCAGAGAGGTAAAGG - Intronic
1084038815 11:66529975-66529997 AGTCAGGGCCAGAGGGGCAGAGG + Intronic
1084105330 11:66976891-66976913 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1084264810 11:67999406-67999428 ACTGAGGCCCAGAGGGCGGAAGG + Intronic
1084462766 11:69305300-69305322 ATGAAGGCCCAGAGGGGCAAAGG - Intronic
1085218321 11:74851399-74851421 ACTGAGGCACAGAGAGGCTAAGG + Intronic
1085255111 11:75168229-75168251 ACCAAGGCCCAGAGTGGGTAAGG + Intronic
1085270023 11:75264777-75264799 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1085309434 11:75507403-75507425 ACTGAGGCCCAGAGGGAGAAAGG + Intronic
1085386973 11:76163115-76163137 ACCAAGGCCGAGAGAGGCGAAGG - Intergenic
1085445281 11:76597297-76597319 ACTGAGGCACAGAGGGGGATAGG + Intergenic
1085526813 11:77168821-77168843 ACTGGGGCCCAGAGAGGCCAAGG + Intronic
1085555087 11:77412210-77412232 ACTAAGGCACAGAGGAGCTCTGG - Intronic
1085752914 11:79177725-79177747 ATAAAGGTCCAGAGGTGCAAGGG + Intronic
1085764757 11:79273125-79273147 ACTAAGGCTCTGAGAGGTAAAGG - Intronic
1085770465 11:79321124-79321146 ACTGAGGCACAGAGAGGCCAAGG - Intronic
1087059182 11:93961878-93961900 TCTGAGGCCCAGAGAGGCTAGGG + Intergenic
1087127309 11:94640699-94640721 TCTGAGGCTCAGAGGGGCAGGGG - Intergenic
1089630515 11:119781373-119781395 AGTGAGGCCCAGAGGGGAAAGGG + Intergenic
1090418821 11:126559312-126559334 ACTAGGGCCCTGAGTGACAATGG - Intronic
1090982985 11:131739759-131739781 ACAAAGTCCCAGATGGGAAACGG + Intronic
1091078874 11:132647242-132647264 ACTAAGGCTCAGAGAAGCTAAGG - Intronic
1091147908 11:133296576-133296598 ACAAAAGCACAGAGGGACAATGG - Intronic
1091681590 12:2531411-2531433 ATTGAGGCCCAGAGAGGAAAGGG - Intronic
1091792167 12:3278216-3278238 ACTGAGGCACAGAGAGGCTAGGG + Intronic
1091923167 12:4321548-4321570 AGTGAGGCCCGGAGGAGCAAGGG + Intronic
1092078664 12:5694560-5694582 ACTGAGGCCGAGAGGGGGAAGGG - Intronic
1092768220 12:11872195-11872217 ACTGAGCCCCAGAGAGGCAAAGG + Intronic
1093709432 12:22313131-22313153 ACTAAGGCTTAGAGAGGCTATGG - Intronic
1093711448 12:22334184-22334206 ACAAACGTCCAGAGGGGCCATGG - Exonic
1096819341 12:54221604-54221626 ACCAAGCCCCAGAGGGAAAAGGG - Intergenic
1098685514 12:73415030-73415052 AAAAGGGCCTAGAGGGGCAAAGG - Intergenic
1099006448 12:77240111-77240133 ACTGAGGTTCAGAGAGGCAAAGG - Intergenic
1099788657 12:87301101-87301123 ACTAAGGGACAGAGGAGCAAAGG + Intergenic
1100382102 12:94071611-94071633 ATTGAGGCCCAGAGAGGCTAAGG - Intergenic
1100397896 12:94200577-94200599 ACTGAGGCCCACAGAGGCTAAGG + Intronic
1100507809 12:95237223-95237245 ACTAAGGCACAGAGAGACCAAGG - Intronic
1101875846 12:108596653-108596675 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1101946167 12:109139202-109139224 ACTAAGATCCAGAGGGGTGAAGG + Intronic
1101960311 12:109244355-109244377 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1102020595 12:109679668-109679690 ACTAAGGTCCAGAGGGGGAAAGG + Intergenic
1102026741 12:109718025-109718047 ACTGGGGCTCAGAGAGGCAAAGG - Intronic
1102028176 12:109725326-109725348 ACTGAGGCTCAGAGAGGCAAAGG + Intronic
1102187919 12:110964352-110964374 ACTAAGGTTCAGAGGGGTGAAGG + Intergenic
1102414009 12:112744694-112744716 ACTGAGGCTCAGAGAGTCAAGGG + Intronic
1102466035 12:113131314-113131336 ACTGAGGCCCAGAGAGGGAAGGG - Intronic
1102697952 12:114814824-114814846 CCTGAGGCCCAGAGGTGCAGGGG + Intergenic
1102797302 12:115699983-115700005 ACTGAGGCTCAGAAGGACAAAGG + Intergenic
1102869372 12:116401667-116401689 ACTCAGGCCCAGAGAGGTTAAGG + Intergenic
1103042512 12:117707531-117707553 ACCAAGGCTCAGAGAGGCCAAGG - Intronic
1103052129 12:117789511-117789533 ACTGAGGCTCAGAGAAGCAAAGG + Intronic
1103720812 12:122974459-122974481 ACTGAGACCCAGAGAGGCACAGG - Intronic
1103737571 12:123070313-123070335 ACTAAGGCCCACACAGGCCAGGG - Intronic
1103933895 12:124465242-124465264 ACTGAGGCCCAGAGAGGGACTGG - Intronic
1109117669 13:58409410-58409432 ACTCAGGACCAGAGGAACAAAGG + Intergenic
1115002473 14:28439503-28439525 TGTAAACCCCAGAGGGGCAAGGG + Intergenic
1116919809 14:50560673-50560695 ACTCGGCCCCAGAGGGGCGAGGG + Intronic
1117107887 14:52417545-52417567 ACTAAGGCTCAGAGAGGTAAAGG - Intergenic
1117195084 14:53331771-53331793 ACCAATACCCAGGGGGGCAAAGG + Intergenic
1117637057 14:57754875-57754897 ACTGAAGCCCAGAGAGGGAAAGG + Intronic
1118743727 14:68759245-68759267 ACTGATGCCCAGAGAGGTAAAGG + Intergenic
1120782936 14:88502263-88502285 GCAAAAGCCCAGAGGGGCTAGGG - Intronic
1121181214 14:91930463-91930485 ACGCAGGCCCAGAGAGGAAATGG - Intronic
1121467973 14:94128222-94128244 ACTGAGGCCCAGAGAGGACAGGG + Intronic
1121520734 14:94584607-94584629 ACTGAGGCCCAGAGGGGGTGAGG + Intronic
1121564148 14:94896073-94896095 ACTGAGGCTCAGAGAGGCCAAGG - Intergenic
1121947170 14:98134415-98134437 ACTGAGGCCCAGAAGGCTAATGG + Intergenic
1121984674 14:98493163-98493185 ACTGAGGCACAGAGGGTCTAGGG + Intergenic
1122136435 14:99635497-99635519 ACTGAGGCCCAGGGAGGAAAAGG - Intergenic
1122227840 14:100290232-100290254 ACCCAGGCCTAGAGAGGCAAAGG + Intergenic
1124940136 15:34210154-34210176 GCTAAGGGCCGGAGGGGAAAAGG + Intergenic
1125271814 15:37947419-37947441 ACTAAGGCACAGAAAGACAAAGG - Intronic
1126468467 15:48982339-48982361 ACTGAGGCCCAGGGAAGCAAAGG - Intergenic
1127609576 15:60623566-60623588 ACTAAGGCCCAGCTAGTCAATGG + Intronic
1128155845 15:65391446-65391468 ACTGAGGCTCAGAGAGGAAAAGG - Intronic
1128157306 15:65400021-65400043 ACTGAGGCTCAGAGAGGCAGTGG - Intronic
1128225090 15:65995961-65995983 ACTGAGGCACAGAGAGGTAAGGG + Intronic
1128315692 15:66657839-66657861 ACTAGAGCCCAGAGAGGGAAGGG + Intronic
1128328916 15:66743006-66743028 ACTGAGGCCCACAGAGGGAACGG - Intronic
1128336288 15:66787647-66787669 ACTGAGGCCCAGAGAGGGCAGGG + Intergenic
1128343119 15:66836520-66836542 ACTGAAGCCCAGAGGGGAGATGG + Intergenic
1128526120 15:68413612-68413634 GCTGAGGCCCAGAGAGGCACCGG - Intronic
1128559919 15:68658093-68658115 ACTGAGGCCTAGAAAGGCAAAGG - Intronic
1128638273 15:69317200-69317222 AGTGAGGCCCAGAGGGGCTTCGG + Intronic
1128701446 15:69807402-69807424 ACCAAGGACCAGCTGGGCAATGG + Intergenic
1128802210 15:70504095-70504117 ACTGAGGCCCAGAGGAGCAAAGG - Intergenic
1128867102 15:71122314-71122336 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1129297162 15:74605956-74605978 GATAAGGCCCAGAGAGGCAGAGG + Intronic
1129410845 15:75349426-75349448 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1129451166 15:75652126-75652148 ACTAAGGCCCAGAGGGGCAAAGG - Intronic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1129660921 15:77552486-77552508 ACTGAGGCACAGAGGGAGAAGGG - Intergenic
1130377396 15:83341194-83341216 ACTGAGGCCCAGCAGGGGAAGGG + Intergenic
1131310320 15:91284704-91284726 ACTGAGGCCCAGAGAAGTAAAGG - Intronic
1132012275 15:98286470-98286492 ACTCAGGTCCAGAGGAGCAGTGG - Intergenic
1133150165 16:3822113-3822135 ACTATGGCCCAGCGGGACAGAGG + Intronic
1133267134 16:4591987-4592009 ACCAAGGCTCAGAGAGGGAAGGG + Intronic
1133569188 16:7024927-7024949 ACTGAGGCCCAGAGAGGAACAGG + Intronic
1134073721 16:11276266-11276288 ACCACGGCCAAGAGGAGCAAGGG - Exonic
1134195781 16:12157820-12157842 GCAAAGGCCCAGAGGCACAAAGG - Intronic
1134300548 16:12986817-12986839 ACTGAGGCTTAGAGAGGCAAAGG + Intronic
1134446599 16:14335967-14335989 ACTGAGGCTCAGAAGGGTAAGGG + Intergenic
1134509108 16:14832069-14832091 ACTGAGGCCCAGAGAGGAAAAGG - Intronic
1134511103 16:14847387-14847409 ACTGAGGCACAGAGGGGTTAAGG - Intronic
1134696809 16:16230903-16230925 ACTGAGGCCCAGAGAGGAAAAGG - Intergenic
1134698745 16:16245883-16245905 ACTGAGGCACAGAGGGGTTAAGG - Intronic
1134833262 16:17340633-17340655 ACTGAGGCACAGAGAGGAAAGGG - Intronic
1134973089 16:18548790-18548812 ACTGAGGCACAGAGGGGTTAAGG + Intronic
1134975028 16:18563793-18563815 ACTGAGGCCCAGAGAGGAAAAGG + Intergenic
1135123177 16:19784393-19784415 ACTGAGGCATAGAGGGGTAAAGG - Intronic
1135977000 16:27115134-27115156 ACTGAGGGCCAGAGAGGCAATGG - Intergenic
1136107280 16:28038978-28039000 ACTGAGGCACAGATGTGCAAAGG + Intronic
1137415656 16:48276199-48276221 ACTAAGGCACAGGGAAGCAAAGG - Intronic
1137448264 16:48545942-48545964 GCTGAAGCCCAGTGGGGCAAAGG + Intronic
1137505228 16:49048868-49048890 ACTGAGGCCCAGAGAGGCTGTGG + Intergenic
1137589141 16:49682744-49682766 ACTGAGGCTCAGAGAGGCTAGGG - Intronic
1137726180 16:50658239-50658261 GCTGAGGCCCAGAGAGGGAAAGG - Intergenic
1137850607 16:51738346-51738368 ACTGAGGCCTAGAGGGAGAAAGG - Intergenic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1138066957 16:53952164-53952186 ACTAAGACCCAGAGAGGTTAGGG + Intronic
1138288197 16:55825735-55825757 ACTGAGGCCCAGACAGGGAAGGG - Intronic
1138303893 16:55956906-55956928 ACTAAGGCCCAGAGAGGGGTCGG + Intergenic
1138429995 16:56962546-56962568 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1138454376 16:57112917-57112939 ACGGAGGCCCAGATGGGGAAAGG + Intronic
1138454572 16:57113960-57113982 ACTGAGGCCCAGAGGGGGATGGG - Intronic
1138515942 16:57535741-57535763 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1138536793 16:57664396-57664418 ACAAAGGCCCAGATGGACAGAGG - Exonic
1138639351 16:58371015-58371037 ACTAAGAACCTGAGGGTCAAGGG - Intronic
1139357733 16:66377321-66377343 ACTGAGGCCCAGAGGGGTCAGGG + Intronic
1139926378 16:70489756-70489778 ACTGAGGCTCAGAGGGCTAAGGG + Intronic
1139963192 16:70729615-70729637 ACGAAGGGCCAGAGAGGTAAAGG - Intronic
1140206431 16:72937368-72937390 ACAAAGGGCAAGAGTGGCAAAGG + Intronic
1140810612 16:78573552-78573574 ACTTAGTCCCAGAGGGCCCAGGG - Intronic
1140963741 16:79943725-79943747 ACTAAGTCCCAGAGAGGGGAGGG + Intergenic
1141151578 16:81568111-81568133 ACCAAGGTCCAGAGGGACCAGGG + Intronic
1141153211 16:81579102-81579124 ACTGAGGCACAGAGAGGCGAGGG - Intronic
1141502663 16:84454638-84454660 ACTGAGGTCAAGAGGGTCAAGGG + Intronic
1141519818 16:84571319-84571341 ACTAAGGCCCAGAGGGAGCCCGG - Intronic
1141620975 16:85236221-85236243 ACTGAGGCCCGGAGGGGTGAAGG + Intergenic
1141636444 16:85316552-85316574 ACTGAGGTCCACAGGGGTAAGGG + Intergenic
1141687740 16:85579907-85579929 ACTAAGGCCCTGAGGAACCAGGG + Intergenic
1141915195 16:87091685-87091707 ACAGAGGTACAGAGGGGCAAAGG - Intronic
1142118715 16:88375307-88375329 ACTGAGGCACAGAGGGGCCAAGG + Intergenic
1142140211 16:88469388-88469410 ACTGAGGCCCAGGCCGGCAAGGG - Intronic
1142205413 16:88780448-88780470 GCTAAGGCAGAGAGGGGCAGGGG + Intronic
1142279467 16:89140218-89140240 ACTGAGGCTCAGAGGGGCAGTGG - Intronic
1142696371 17:1636012-1636034 ACAAAGGCCCAGAGGTGAGAGGG - Intronic
1143027702 17:3950901-3950923 ACTGTGGGCCAGAGGGGCAGGGG - Intronic
1143096790 17:4482647-4482669 TCTATGGCCCAGCGGGGCCAAGG - Intronic
1143294580 17:5861170-5861192 AGGAAGGTCCAGAGGGACAAGGG - Intronic
1143675794 17:8431382-8431404 ACTGAGACCCAGAGGAGCTAGGG - Intronic
1143921782 17:10336082-10336104 ACTGAGGCCCAGAGAGGTGAAGG + Intronic
1144353473 17:14422107-14422129 ACAAAAGCCCAAAGGGGCGAGGG - Intergenic
1144774398 17:17777754-17777776 ACTGAGGCCCAGAGGGGCCCAGG + Intronic
1144828125 17:18117944-18117966 ACTGAGGCCCAGAGAGGACAAGG + Intronic
1144846950 17:18225178-18225200 ACTGAGGCGCAGAGGGGCCAGGG + Intergenic
1144998002 17:19283940-19283962 AATGAGGCCCAGAGCAGCAAAGG - Intronic
1145270380 17:21401599-21401621 ACTGAGGCCCAGAGGGGACAGGG + Intronic
1145302046 17:21647805-21647827 ACTGAGGCCTAGAGAGGGAAGGG - Intergenic
1145308591 17:21688996-21689018 ACTGAGACCCAGAGGGGACAGGG + Intergenic
1145328393 17:21850589-21850611 ACTGAGGCCTAGAGAGGTAAGGG - Intergenic
1145348264 17:22055511-22055533 ACTGAGGCCTAGAGAGGGAAGGG + Intergenic
1145933631 17:28702706-28702728 ACCAAGGCCCAGCTGGGAAAAGG - Intergenic
1146125024 17:30224626-30224648 ACCCAGGCCCAGAGGGTCTACGG + Intronic
1147582774 17:41636451-41636473 ACTGAGGCCCAGAGAGGAAGAGG - Intergenic
1147865342 17:43548337-43548359 ACTCAGAACCAGAGGGGCACTGG - Intronic
1147875201 17:43616152-43616174 ATTGAGGCCCAGAGAGGGAAAGG + Intergenic
1148210606 17:45806350-45806372 ACTGAGGCACAGAGAGGTAAGGG - Intronic
1148458018 17:47821312-47821334 ACTGAGGCCCAGAGGGGACAGGG + Intronic
1150290726 17:63980080-63980102 ACTAAGGCCCAGAGGGGACCAGG + Intergenic
1150645935 17:66977506-66977528 ACTGAGGCCCAGAGAAGCTAAGG - Intronic
1151306032 17:73263113-73263135 ACTAAGGCCAAGAGAAGCCAGGG - Intergenic
1151510214 17:74554154-74554176 CCTAAGGTCCAGAGGGGCCTGGG - Intergenic
1151567164 17:74905120-74905142 ACTGAGACCCAGAGGGGAAGGGG - Intergenic
1152089704 17:78239788-78239810 ACTGAGGCCCAGAGCGGCAGAGG + Exonic
1153719999 18:7892040-7892062 AATAGGTCCCAGAGGGGCAGTGG - Intronic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1154323499 18:13372902-13372924 ACAAAGGCCCAGATGGTGAACGG - Intronic
1156481461 18:37439123-37439145 ACTGAGGCCCAGAGAAGCAAAGG + Intronic
1157248836 18:46076174-46076196 TCTAAGGTCCAGAAGGGCATGGG - Intergenic
1157297906 18:46459275-46459297 ACTAAGGCCCAGAGAGACAAAGG - Exonic
1157669425 18:49515784-49515806 AGAAAGGCCCAGAGGCACAAGGG - Intergenic
1157964242 18:52190197-52190219 ACTGAGGCCCAGAGAGGGCAAGG - Intergenic
1159058726 18:63492368-63492390 ACTGAGGCTCAGAGAGGCCAAGG - Intronic
1159666049 18:71161906-71161928 ACTGAGGCCCAGAGAAGGAAAGG - Intergenic
1160175961 18:76594409-76594431 ACTGAGGCACAGAAGGGCTACGG + Intergenic
1160775296 19:852673-852695 ACTGAGGCACGGAGAGGCAAAGG - Intronic
1160789816 19:918229-918251 ACTGAGGCTCAGAGGGTCAGGGG + Intronic
1160817423 19:1042607-1042629 ACTGAGGCTCTGAGAGGCAAAGG - Intronic
1161262372 19:3345121-3345143 ACTGAGGCTCAGAGAGGGAAAGG - Intergenic
1161272630 19:3398473-3398495 ACTGAGGCCCAGAGAGGGCAGGG - Intronic
1161283298 19:3456957-3456979 ACTGAGGCCCAGAGAGACAAGGG + Intronic
1161346862 19:3772443-3772465 ACTGAGGCCCAGAGAGGGAGAGG - Intergenic
1161615559 19:5268412-5268434 ACAAAGGCCCAGATGGGACATGG + Intronic
1161630667 19:5353687-5353709 ACTGAGGCTCAGAGAGGAAAGGG + Intergenic
1161646111 19:5454502-5454524 GCTGAGGCCCAGAGAGGCTAAGG + Intergenic
1161700826 19:5794168-5794190 ACTGAGGCCCAAAGAGGGAAGGG + Intergenic
1161836697 19:6652531-6652553 ACTGAGGCCCAGAGATGCCAAGG + Intergenic
1161953169 19:7478753-7478775 GCTGAGGCCCGGAGGGGAAACGG - Intronic
1162453761 19:10770007-10770029 ACTGAGGCCCAGAGGGGTTAAGG - Intronic
1162460852 19:10813078-10813100 ACTGAGGCCCAGAGAGGCAAGGG - Intronic
1162550359 19:11355203-11355225 ACTGAGGCCCAGAGAGGGAGAGG + Intergenic
1163475710 19:17525007-17525029 ACTGAGGCCAATAGGAGCAATGG + Intronic
1163526600 19:17825167-17825189 ACTGAGACCCAGAGAGGGAAAGG + Exonic
1163573703 19:18098445-18098467 ACTGAGGCCCAGAGAAGCAAGGG - Intronic
1163665538 19:18602218-18602240 ACCAAGGCCCAGAGGAGGAGGGG + Intronic
1163772040 19:19197129-19197151 ACTGAGGCACAGAGAAGCAAGGG + Intronic
1164159989 19:22620161-22620183 ACTGAGTCACAGAGGGGCACAGG - Intergenic
1165108546 19:33488210-33488232 ACTGAGGCACAGAGGAGCAATGG + Intronic
1165479264 19:36052486-36052508 ACAAAGGCCCATAGGGCCTATGG - Intronic
1165793093 19:38504138-38504160 ACGAAGGCCCAGAGAGACACAGG - Intronic
1165927108 19:39333738-39333760 ACTGAGGCCCAGAGGTGTTAAGG + Intronic
1165931633 19:39362867-39362889 ACTGAGGTCAGGAGGGGCAATGG + Intronic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166376656 19:42331227-42331249 ACTAAGGCTCAGAGAGCCCATGG + Intronic
1166520057 19:43474326-43474348 ACAAAGGCCCAGAGGTGAAAGGG + Intergenic
1167107403 19:47438230-47438252 ACTAAGGCACAGAGAGGCTCAGG - Intronic
1167467752 19:49659048-49659070 ACTGAGGCACAGAGCAGCAAGGG + Intergenic
1167609788 19:50501594-50501616 ACTCAGGCACAGGGAGGCAAGGG - Intergenic
1167732343 19:51267686-51267708 GCTAAGGCCCAGAGAGGAGAAGG + Intronic
1168262194 19:55201954-55201976 AATATGGCCCAGAGGGACTATGG + Intronic
925346722 2:3176851-3176873 AGGAAGGCCCAGAGGGGAGAAGG + Intergenic
925804325 2:7633304-7633326 ACTAAGGCCCACAGAGGCTACGG + Intergenic
926623630 2:15070965-15070987 ACTGAGACCCAGAGAGGAAAAGG + Intergenic
926972788 2:18483773-18483795 ACCAAGGCCCAGAGAGGGGAAGG - Intergenic
927155376 2:20218178-20218200 ACTGAGGCCCAGAGAGGCAATGG + Intronic
927198316 2:20563295-20563317 ACTGAGGCCCAGAGAGGGAAGGG + Intronic
927207669 2:20620264-20620286 ACTGAGGTGCAGAGAGGCAAAGG + Intronic
928093672 2:28391645-28391667 ACTGAGGCCCAGAGAGGTTAAGG + Intergenic
928267312 2:29822604-29822626 ACTGAGGCTCAGAGAGGCCAAGG - Intronic
929002926 2:37366019-37366041 ACAAAGGCAGAAAGGGGCAAGGG + Intronic
930827085 2:55705626-55705648 ACTGAGGGAGAGAGGGGCAAAGG + Intergenic
931799974 2:65748788-65748810 GCTAAGCCCCAGAGGGTCTACGG - Intergenic
932345739 2:70994329-70994351 ATGAAGGGCCAGAGGCGCAAAGG + Intronic
932569765 2:72932396-72932418 ACTGAAGCCCAGAGGGGGAAGGG + Intronic
932688970 2:73896507-73896529 ACTAAGGCCCAGGGAAGGAAGGG + Intronic
933773353 2:85757330-85757352 ACTGAGGCCCAGAGGAGGAAGGG - Intronic
934848200 2:97676928-97676950 ACTAAGGCCCAGATGGAAGATGG + Intergenic
936059698 2:109286398-109286420 CTGGAGGCCCAGAGGGGCAAAGG + Intronic
937287008 2:120760160-120760182 ACTGAGGCCCACGGGGGCCAGGG - Intronic
937453304 2:122020239-122020261 ACTGAGGCTCAGAGGGGTGACGG + Intergenic
937740500 2:125347082-125347104 ACTAAGGCACAGAGTGGCTGAGG - Intergenic
938018092 2:127884982-127885004 GATAAGGCCCAGAGGGATAAGGG + Intronic
938786133 2:134631558-134631580 ACTAAAGCCCAGAAAGGCCAAGG + Intronic
939026512 2:137020325-137020347 AGAAAGGCCCAGATGGTCAAGGG + Intronic
940090910 2:149915915-149915937 ACTGAGGTCCAGAGAGGTAAAGG - Intergenic
941421114 2:165283822-165283844 ACTCTGGCTCAGAGTGGCAATGG + Intronic
941586197 2:167362619-167362641 AATAAGGCCCAGAAGGAAAAAGG - Intergenic
942276813 2:174328941-174328963 ACCAAGGCCCCGAGGGGCGGCGG - Intergenic
943094961 2:183417384-183417406 GCTTTGTCCCAGAGGGGCAAGGG - Intergenic
945917202 2:215716503-215716525 ACTGAGGCCCAGACAGGCAGGGG + Intergenic
946015674 2:216602308-216602330 ACTGAGGCCAAGATGGGCAGAGG + Intergenic
946065746 2:216985862-216985884 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
946611361 2:221461631-221461653 AACAAGGCCGAGAGGGGGAATGG + Intronic
947219856 2:227781731-227781753 ACTAAGGGCCATAAGGCCAAAGG - Intergenic
947228822 2:227865388-227865410 ACTAAAGCCCAGAGAGGTGATGG + Intergenic
947650500 2:231782109-231782131 ATTGAGGCCCAGAGAGGCGAAGG + Intronic
947754429 2:232551133-232551155 ACTGAGGCTCAGAGGGGAGAGGG - Intronic
948424501 2:237878527-237878549 ACCCAGGCTCAGAGGGGCAGTGG - Intronic
948558519 2:238835022-238835044 ACTGAGGCCCACAGTGGCGAAGG + Intergenic
948703143 2:239773227-239773249 ACTAAGGCACAGAGTAGCAGTGG - Intronic
948917273 2:241040670-241040692 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
1168831335 20:846783-846805 ACTGAGGCCCAGAGGGAAACTGG - Intronic
1168858729 20:1029402-1029424 ACTCAGGCCCAGAGAGGAAGAGG - Intergenic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1169779174 20:9290942-9290964 ACTAAGACTCAGAGGGTTAAGGG + Intronic
1169811187 20:9610928-9610950 AAAAAGGCCAAAAGGGGCAAAGG - Intronic
1171320385 20:24238604-24238626 AATAAGGCTCAGAAGGACAAAGG - Intergenic
1171961610 20:31498683-31498705 ACTGAGTCCCAGAGAGGAAAAGG - Intergenic
1172145996 20:32758971-32758993 ACTGAGGCCCAGAGAAGGAAGGG - Intergenic
1172184543 20:33023200-33023222 ACTGAGGCCCAGAGAGGCAAAGG + Intronic
1172225357 20:33301923-33301945 ATTGAGGTCCAGAGGGGGAAAGG + Intronic
1172484793 20:35291726-35291748 ACTGAGGTCCAGAGAGGGAAGGG - Intronic
1172595608 20:36149170-36149192 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1172701095 20:36854204-36854226 ACTAAGGCCCAGAGAGGTTAAGG - Intronic
1172750139 20:37245053-37245075 ACCAAGGCCCAGAGAGGTAAAGG - Intergenic
1172807649 20:37624142-37624164 ACCGAGGCCCAGAGAGGTAAAGG + Intergenic
1172869840 20:38129239-38129261 ACAAAGGCCCAGAGAGGAGAAGG + Exonic
1173263624 20:41458930-41458952 ACTAACTCACAGAGGAGCAAGGG - Intronic
1173569316 20:44066494-44066516 ACTGAGGCCCAGAAAGGGAAAGG + Intronic
1173907745 20:46641117-46641139 ACTGAGGCCCAGAAGGGGACTGG - Intronic
1174303610 20:49600029-49600051 AGTGAGGCCCAGAGGGGTAGTGG - Intergenic
1174370473 20:50083790-50083812 AATAAGGCCCAGGGGGGTAAAGG + Intronic
1174379342 20:50146673-50146695 ACCAAGGCTCAGAAGGGGAACGG + Intronic
1174404051 20:50292475-50292497 ACCAAGGCCCAGAGAGGGCAAGG - Intergenic
1174858642 20:54069743-54069765 ACTGAGGCCCAGAGGGCTGAGGG + Intronic
1175310802 20:58010567-58010589 ACTGAGGCACAGAGAGGTAAAGG - Intergenic
1175318082 20:58065823-58065845 ACTGAGGCCCAGAGAGGTTAAGG - Intergenic
1175831175 20:61966103-61966125 ACTGAGGCTCACAGGGGAAAGGG + Intronic
1176652776 21:9565638-9565660 ACTGAGGCCTAGAGAGGGAAGGG - Intergenic
1177682098 21:24385074-24385096 ACTGAGGGCCAGAGAGGCAGTGG - Intergenic
1177728952 21:25003838-25003860 ACTAGGGCCTAAAGGGGAAATGG - Intergenic
1180704493 22:17800753-17800775 ATGCAGGCACAGAGGGGCAAGGG + Intronic
1180982400 22:19885005-19885027 GCAAAGGCCAAGAGGGGCAGGGG + Intronic
1181163416 22:20970929-20970951 CTTAAGGCCCAAAGGGGCTAAGG + Intronic
1181555665 22:23670453-23670475 ACTGAGTCTCAGAGGGGCTAAGG + Intergenic
1181571921 22:23772604-23772626 ACTGAGACCCAGAGCGGCACGGG + Intronic
1181646730 22:24235395-24235417 ACCAAGGCCCAAAGAGGGAATGG + Intronic
1182024592 22:27108133-27108155 GCTGAGGCCCAGAGAGGGAAGGG - Intergenic
1182100476 22:27654345-27654367 ACTGAGGCCCAGAGAGGGAAAGG + Intergenic
1182120208 22:27781544-27781566 ACTGAGGCCCAGAGAGGAACTGG + Intronic
1182376023 22:29848786-29848808 ACTGAGGCCCAAAGAGGGAATGG + Intergenic
1182392230 22:30008082-30008104 ACTAAGTCTCAGTTGGGCAAGGG - Intronic
1182418614 22:30237670-30237692 ACTGAGGCCCAGGGAGGCAGAGG - Intergenic
1182430648 22:30297070-30297092 ACTGAGGGCCAGAGAGGGAAAGG - Intronic
1182453455 22:30434646-30434668 ACCAAGGCCCAGAAAGGGAAAGG - Intergenic
1182547863 22:31085993-31086015 AAAGAGGCCCAGAGGGGCAAGGG - Intronic
1182570299 22:31232344-31232366 ACTGAGGCTCACAGGGGCTAAGG - Intronic
1183263194 22:36809564-36809586 ACTGAGGCTCAGAGAGGCTAAGG - Intronic
1183351967 22:37339472-37339494 ACTGAGGCACAGAGAGGCTATGG - Intergenic
1183377641 22:37474349-37474371 ACTGAGGCCTAGGGTGGCAAAGG - Intronic
1183382273 22:37496142-37496164 ACTTAGGTCCAGAGGGGGCAGGG + Intronic
1183538442 22:38416346-38416368 ACTGAGGCCCAGACAGGAAAGGG - Intergenic
1184100687 22:42340484-42340506 ACTGAGGCTCAGAGGGCCCAGGG + Intronic
1184111540 22:42398355-42398377 ACCAAGGCCCAGAGGGGAACTGG - Intronic
1184161261 22:42698634-42698656 ACAGAGGCCCCGAGAGGCAAAGG + Intronic
1184249533 22:43252336-43252358 ACTGCGGCTCAGAGGGGCTAAGG - Intronic
1184268913 22:43366398-43366420 ACTGAGGCCCAGGGAGGGAAGGG + Intergenic
1184412697 22:44333949-44333971 ACTGAGGCCAAGAGAGGCCATGG + Intergenic
1184512145 22:44940053-44940075 ACTGAGGCCCAGGGTGGCAGTGG - Intronic
1184606852 22:45579294-45579316 ACTGAGGCCCGGAAGGGCGAGGG + Intronic
1184678810 22:46058761-46058783 ACTGAGGACCAGAGGGGCCAAGG - Intronic
1184685330 22:46094278-46094300 ACTGGGTCCCAGAGAGGCAAAGG + Intronic
1185116077 22:48939064-48939086 ACTAAGGCCCAGGAGGAAAAAGG + Intergenic
1185190823 22:49434716-49434738 AGTGAAGCCCAGAGGGGCAATGG + Intronic
950109369 3:10408666-10408688 ACCAAGGCCCAGAGAGGGGAAGG - Intronic
950116769 3:10455831-10455853 ACTGAGGCCCAGAGAAGAAAGGG - Intronic
950184904 3:10938995-10939017 ACTGAGGCCCAGGGAGGGAAAGG - Exonic
950404812 3:12797607-12797629 ACTGAGGCCCAGGGAGGAAAAGG + Intronic
950472951 3:13197770-13197792 ACTGAGGTCCAGAGAGGCCAAGG + Intergenic
950577514 3:13841652-13841674 TCGAAGGCACAGAGGGGAAAAGG + Intronic
951540411 3:23776740-23776762 ACTCAGTCCCAGAGGGACAAAGG - Intergenic
952944398 3:38467959-38467981 ACTTAAGCCTAGAGGGGCAGTGG - Intronic
953025016 3:39139758-39139780 ACTAAGACCCAGAGAGGGGAAGG - Intergenic
953039084 3:39238875-39238897 AATAAGGCCCAGAGAGGTTAAGG - Intergenic
953418486 3:42736445-42736467 ACTGAGGCCCAGAGAGTCCAAGG + Intronic
953432553 3:42851753-42851775 ACTGAGGCCCAGAGATGGAAAGG - Intronic
953465263 3:43114323-43114345 ACTGAGACCCAGAGAGGCATAGG + Intergenic
953670856 3:44960796-44960818 ACTATGGCTCTGAAGGGCAAAGG + Intronic
953671349 3:44964936-44964958 ACTGAAGCCCAGAAAGGCAAAGG + Intronic
953680151 3:45033117-45033139 ACTGAGGCTCAGAGTGGCACTGG - Intronic
953938948 3:47073375-47073397 AATAAGGCTAAGAGGGCCAAAGG + Intronic
954275422 3:49538886-49538908 ACTGAGGCCCAGAGAGGGCAAGG + Intergenic
954393490 3:50279727-50279749 ACTGATGCTCAGAGGGGCCAGGG + Intronic
954462449 3:50635046-50635068 ACAGAGGCCCAGAGAGGAAAAGG + Intronic
954575522 3:51673974-51673996 ACTGAGTCACAGAGGGGCACAGG - Intronic
954602015 3:51877636-51877658 ACTAGAGCCCAGAGGAACAAGGG + Intergenic
954628863 3:52037582-52037604 ACTGAGGCCCAGAAAGGCCAGGG + Intergenic
955368838 3:58333277-58333299 GCTGAGGCCCGGAGGGGCCAAGG + Intronic
955483411 3:59412248-59412270 AGTAAGGCCCAGGGGGATAAGGG - Intergenic
956101896 3:65777240-65777262 ACTGAAGCCCAGAGAGGCTAAGG - Intronic
956631420 3:71320258-71320280 TCTAAGGCCCGGAAGGCCAAGGG + Intronic
959908035 3:111731953-111731975 ACAAAGGCTCAAAGGGGTAATGG - Intronic
961465467 3:127078490-127078512 ACTAAGGCCCAGAGAGGAGAAGG + Intergenic
961518686 3:127454785-127454807 ACTGAGGCCCAGAGAGCCGAAGG - Intergenic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
961865352 3:129949822-129949844 ACTGAGTCCCAGAGAGGCAGAGG - Intergenic
962843917 3:139258937-139258959 ACTGAGGCCCAGAGAGGGAAAGG - Intronic
962967124 3:140365594-140365616 ACTAAGGCCCAGAGAGGTGAGGG + Intronic
964418164 3:156471930-156471952 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
964766857 3:160187768-160187790 ACTGAAGCCCAGAGTGGCTAGGG + Intergenic
965113107 3:164451954-164451976 ACTGAGGACAACAGGGGCAACGG + Intergenic
965613190 3:170566084-170566106 TTTAAGGCCCAGAGAAGCAAAGG + Intronic
965709852 3:171546201-171546223 ACCAAGTCCCAGAGAGGCCAAGG + Intergenic
967387762 3:188927897-188927919 ACTAAGGCCCAGGGAGGAGATGG + Intergenic
967785720 3:193492325-193492347 ACAAAGGTCCAGAGAGGAAAAGG + Intronic
968045284 3:195620502-195620524 ACTGAGGCCCAGAGAGGGACAGG - Intergenic
968061139 3:195726845-195726867 ACTGAGGCCCAGAGAGGGACAGG - Intronic
968922842 4:3531601-3531623 ACGGAGGCCCCGAGGGGAAAGGG - Intronic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969238580 4:5885310-5885332 GCTGAGGCTCAGAGGGGCACAGG + Intronic
969350198 4:6593884-6593906 ACCAAGGCCCAGAGAGGTTAAGG + Intronic
969366309 4:6696387-6696409 GATAAGGCCCAGAGGGCCCAAGG - Intronic
969498029 4:7537198-7537220 ACTGAGGCCCAGAGAGGAAATGG - Intronic
969612632 4:8235831-8235853 ACTGAGGCTCAGAGAGGCACAGG + Intronic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
970135816 4:12922421-12922443 ACAAAAGCTCAGAGGAGCAAAGG - Intergenic
970152104 4:13101009-13101031 AGTAAAGTCCAGTGGGGCAATGG + Intergenic
970455440 4:16219129-16219151 ACCAAGGCCCAGAGAGGCTAAGG + Intronic
971274228 4:25180540-25180562 ACTGAGGCTCAGAGAGGGAAGGG + Intronic
974062824 4:57051158-57051180 ACTATGGCCAAGATGGGGAAGGG + Intronic
975647422 4:76558942-76558964 CCTGGGGCCCAGAGGGGAAAGGG - Intronic
976137625 4:81955904-81955926 CCTGAGGCTCAGAGGGGCTAAGG - Intronic
980551444 4:134341821-134341843 ACTAAGTCTCAGAGAGGAAAGGG - Intergenic
982136333 4:152277390-152277412 ACTGAGGCTTAGAGGGGCTAAGG - Intergenic
983498467 4:168472132-168472154 AATTAGGCTCAGAGAGGCAAAGG + Intronic
983999858 4:174226659-174226681 ACTTAGGCACCGAGGGCCAAGGG + Intergenic
985321477 4:188716537-188716559 ACTGAGGCCCAGAGAGGACAGGG + Intergenic
987906697 5:24087771-24087793 ACAGAGGCCCAGAGAGGCTAAGG + Intronic
988586452 5:32511647-32511669 ACTGGGGCTCAGAGGGACAAAGG + Intergenic
988948356 5:36230542-36230564 ACTTAGGCCCTGAGGAACAATGG - Intronic
991504250 5:67307704-67307726 ACTAAGGCCACGAGAGGCAGTGG + Intergenic
992848859 5:80783764-80783786 ACTCATGTCCAGAGAGGCAAGGG + Intronic
994051454 5:95366522-95366544 ACTGAGGCTCAGAGAGGCCAGGG + Intergenic
994087851 5:95779849-95779871 AGTCAGGCCCAGAAGGGTAATGG + Intronic
995061523 5:107815772-107815794 ACCAAGCCTCAGAGGGGCGAAGG + Intergenic
995721687 5:115141543-115141565 CCTTAGGCACAGAGGGCCAAAGG + Intronic
995745117 5:115394514-115394536 ACCAAGACCCAGAGAGGAAAGGG + Intergenic
995836460 5:116404677-116404699 ACTAAAGCCCAGAGAGGTTAAGG - Intronic
997328525 5:133042324-133042346 AGGAAGGCTCAAAGGGGCAAAGG - Intergenic
997595702 5:135105921-135105943 ACTAAGGCACAGAGAGGTTATGG + Intronic
997598555 5:135123897-135123919 ACCAAGGCCCAGAGAGGTGAAGG + Intronic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998456150 5:142275087-142275109 ACGAAGGCCCAGAGACCCAAAGG + Intergenic
998483102 5:142479407-142479429 ACAGAGTCCCAGAGGGCCAAGGG + Intergenic
998897190 5:146812134-146812156 ACTAAGGTTCAGAGAGGTAATGG - Intronic
998960679 5:147483162-147483184 ATTAAGGCCCAGAAAGGTAAAGG + Intronic
999156065 5:149458411-149458433 ACTGAAGCCTAGAGAGGCAAAGG + Intergenic
999195063 5:149776280-149776302 ACCAAGGCCCAGAGAGGGAAAGG - Intronic
999245154 5:150150293-150150315 ACTAAGGTCCAGAGAGGGGAAGG - Intronic
999281316 5:150368069-150368091 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
999443002 5:151616970-151616992 ACTGAGGCCCAGAGAGGGAAAGG - Intergenic
999486536 5:152002668-152002690 AATAAGACCCAGAGAGGGAAAGG - Intergenic
999601340 5:153269549-153269571 ACCAAGGCTCAGAGGCGGAAAGG + Intergenic
999869595 5:155735482-155735504 ACTGAGGCTCAGAGGGGGAAAGG + Intergenic
1000147804 5:158470248-158470270 ACTGAGGCCCAGATGGGGATGGG - Intergenic
1001093388 5:168757920-168757942 ACTAAGGCTCAGAAAGGCTAAGG + Intronic
1001182422 5:169533018-169533040 ACTGAGGCTCAGAGTGGCTAAGG - Intergenic
1001812211 5:174637440-174637462 ACTGAAGCTCAGAGGGGAAATGG - Intergenic
1001948851 5:175801930-175801952 CCAAAGGCCCAGAGAGGGAAGGG + Intronic
1002062903 5:176636926-176636948 GCTGAGTTCCAGAGGGGCAAGGG - Intronic
1002322608 5:178384623-178384645 ACCAAGGCTCAGAGGGGGCAGGG + Intronic
1002459670 5:179367104-179367126 ACCGAGGCCCAGAGGGGCAGGGG - Intergenic
1003105161 6:3209920-3209942 ACTAAAGCCCAGAGAGGTTAAGG + Intergenic
1003974104 6:11326664-11326686 ACAAAGGCCAGGAGGGGCAGAGG - Intronic
1004226761 6:13792165-13792187 ACTAAGGCCTAGAGAGGTTAAGG - Intronic
1006378279 6:33683767-33683789 ACTGAGGCTCAGAGAGGCTAAGG + Intronic
1006435429 6:34023617-34023639 AGTAAGGGCCAGAGGGACAGGGG - Intronic
1006718698 6:36136368-36136390 ACTGAGGCCCAGAAGGGGAAGGG + Intronic
1006808920 6:36807320-36807342 ACTGAGGCACAGAGAGGTAAAGG - Intronic
1007697687 6:43744155-43744177 ACAAAGGCTCAGAAGGTCAAGGG - Intergenic
1007843393 6:44734966-44734988 ACTGAGGCCCAGAGGTGAGAAGG + Intergenic
1012326315 6:97922985-97923007 ACTGAGGCCCAGAGAAGCTAAGG + Intergenic
1014074595 6:117221878-117221900 TATCAGGCCCAGAGAGGCAATGG - Intergenic
1016110858 6:140221408-140221430 ACTAAGGATCAGAGCTGCAAAGG + Intergenic
1017115346 6:150970938-150970960 TTTAAGGCCCAGAGAGGCTAAGG - Intronic
1018124581 6:160669483-160669505 ACTCATACCCAGAAGGGCAAAGG - Intergenic
1019267383 7:125453-125475 ACTGAGGCCCAGAGGGAGAAGGG + Intergenic
1019312131 7:368012-368034 ACTGAGGCCCAGAGAGGGATGGG + Intergenic
1019314164 7:376905-376927 ACCCAGGCCCCGAGGTGCAAGGG + Intergenic
1019486795 7:1293121-1293143 ATCAAGACCCAGAGGGGCTAAGG - Intergenic
1019492810 7:1323056-1323078 ACTGAGGCCCAGAGAGGCGCAGG + Intergenic
1019572869 7:1721328-1721350 ACTTAGGCCCTGAGAGGGAAAGG - Intronic
1019793304 7:3031622-3031644 ACTGAGCCCCAGAGGTGAAAGGG + Intronic
1023570359 7:41565479-41565501 ACTGATGCCCCGAGGGGCTAGGG + Intergenic
1024088769 7:45918780-45918802 ACTAAGACCCAGAGAGGAGAGGG - Intronic
1024247294 7:47479971-47479993 ACCAAGGCTCAGATGGGCAGGGG + Intronic
1024361528 7:48473744-48473766 AATCAGGCCCAGAGAGGCACTGG - Intronic
1026450170 7:70521871-70521893 ACTGAGGCTCTGAGAGGCAAAGG - Intronic
1026868760 7:73838296-73838318 ACTGAGGCCCAGAGAGGTGAAGG - Intronic
1026896143 7:74011063-74011085 TCTGAGGGCCAGAGGGGCAGTGG - Intergenic
1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG + Intergenic
1026970307 7:74463686-74463708 ACTCTGGCCCAAAGGGGCACAGG - Intronic
1028517960 7:91698814-91698836 ACTAAGCTCCAGAGGGGGTAAGG + Intronic
1028912075 7:96219520-96219542 AAACAGGCCCAGAGGGGAAAAGG - Intronic
1029608877 7:101616053-101616075 ACCAAGGCCCAGAGAGGGGAAGG + Intronic
1029705335 7:102273004-102273026 AGTGAGGCCCAGAGAGGGAAAGG + Intronic
1033439431 7:141365467-141365489 ACTGAGGCTCAGAGGGGTGAAGG - Intronic
1034163276 7:149007614-149007636 ACTCAGCCCTAGAGGGGCAGTGG - Intronic
1034980702 7:155474263-155474285 ACCAAGGCCCAGAGAGGAAAAGG - Intronic
1035764969 8:2098536-2098558 ACTGAGGCCCAGAGAGGCGACGG - Intronic
1036781680 8:11651980-11652002 ACTGAGGCCCAGAGAGGTGAAGG + Intergenic
1036823414 8:11957524-11957546 ACTGAGGCTCGGAGAGGCAAAGG - Intergenic
1036929601 8:12942203-12942225 GATCAGGCCCAGAGAGGCAAGGG - Intergenic
1037161397 8:15777691-15777713 TCTAAGACACAGAGAGGCAAAGG + Intergenic
1037885232 8:22592517-22592539 ACTAAAGCCCAGAGAGGTTAAGG - Intronic
1038260487 8:25989098-25989120 ACTGAGGCCCAAAGAGGCTAAGG - Intronic
1038823854 8:30979008-30979030 AGTAAGGCCCAGAGTAGTAAAGG - Intergenic
1039439900 8:37587973-37587995 ACTGAGACCCAGAGAGGCGAGGG + Intergenic
1039494695 8:37972152-37972174 CCTGAGGCCCAGAGAGGAAATGG + Intergenic
1040072553 8:43200370-43200392 GCCAAGGCCCAGACGGGCCAAGG - Exonic
1040555926 8:48477725-48477747 ACTGAACCGCAGAGGGGCAAGGG - Intergenic
1041032386 8:53751016-53751038 ACCAAGGCACAGAGAGGTAAAGG + Intronic
1042691073 8:71499417-71499439 ACTGAGGCACAGAGGTGCTAAGG + Intronic
1044219049 8:89648377-89648399 AATAAAGCCCAGAAGAGCAACGG + Intergenic
1044450947 8:92335511-92335533 ACAAAGTGCCTGAGGGGCAAGGG - Intergenic
1045099408 8:98829236-98829258 ACTCAGGCCCAAAGGGTCAAGGG - Intronic
1046360308 8:113144996-113145018 AATAGAGCCCTGAGGGGCAAGGG + Intronic
1046893084 8:119444458-119444480 ACTAAGGCCCAGAGAGAATAAGG - Intergenic
1047224275 8:122943417-122943439 ACTAAGGCTCAGAGAGGTTAAGG - Intronic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1049079134 8:140427984-140428006 ACTGAAGCCCAGAGGAGCCAAGG + Intronic
1049204088 8:141355319-141355341 ACTGAGGCTCAGAGGGAGAAAGG - Intergenic
1049207156 8:141368947-141368969 ACTGAGGCCCAGAGAGGCACAGG + Intergenic
1049234852 8:141507403-141507425 ACTGAGGCCCAGAGAAGGAAGGG - Intergenic
1049261061 8:141639448-141639470 ACTGAGGCCCAGAGAGGGAGCGG + Intergenic
1049461839 8:142733614-142733636 ACTGAGGCTCAGAGGAGCTATGG + Intronic
1049499670 8:142955180-142955202 GCTCAGGCTGAGAGGGGCAATGG - Intergenic
1049534101 8:143170043-143170065 ACTAAAGGCCACAGGGGCCAGGG + Intergenic
1052544734 9:29861686-29861708 ACTAAGGCTAATAGGAGCAATGG + Intergenic
1053198927 9:36139628-36139650 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1053419550 9:37968841-37968863 ACTAAGGCTCAGAGTGGAGAAGG - Intronic
1056447595 9:86680917-86680939 ACAAAGGCACAGGGGTGCAAGGG - Intergenic
1057316913 9:93975439-93975461 ACTCAGGTCCAGAGGCGCAGGGG - Intergenic
1057506869 9:95641811-95641833 ACTGATGCCCAGAGAGGCTAAGG + Intergenic
1057799319 9:98180521-98180543 ACTGAGGCTCAGAGAGGCCATGG - Intronic
1057810289 9:98252116-98252138 ACTGAGGCCCAGAGCAGCTAAGG - Intronic
1057847900 9:98539520-98539542 ACTAAGGCCCAGAGAGGGAAGGG - Intronic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1058734247 9:107879437-107879459 ACTGAGGCCCAGAGGGTTGAGGG + Intergenic
1058852488 9:109026488-109026510 ACAAAGGCCCAGAGTTTCAATGG + Intronic
1058924697 9:109651356-109651378 ATCAAGTCCCAGAGGAGCAAAGG - Intronic
1059307935 9:113369299-113369321 AATAAGGCCCAGAGAGAAAAAGG - Intronic
1059429078 9:114239431-114239453 GCTGAGGCCCAGAGAGGCTAAGG + Intronic
1059433255 9:114262265-114262287 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1059484115 9:114613808-114613830 ACTAGAGTGCAGAGGGGCAAGGG + Intronic
1059757730 9:117309649-117309671 ACTGAGGCCAAGAGAGGGAAAGG + Intronic
1060029736 9:120204035-120204057 ACTGAGGCCCAGAGAGGCCATGG - Intergenic
1060267939 9:122123044-122123066 ACTGAGGCCCAGAGAGCCCAAGG + Intergenic
1060344265 9:122802961-122802983 ACTGAGGCCCAGAGTGGTTAAGG + Intronic
1060519435 9:124285968-124285990 ACTGAGGCCCAGAGAGGGCAAGG + Intronic
1060548934 9:124476203-124476225 AATGAGGCCCAGAGAGGGAAGGG - Intronic
1060737234 9:126073758-126073780 ACTGAGGACCAGAGGGAGAAGGG + Intergenic
1060877295 9:127092663-127092685 ACTGAGGCCCAGAGAGGCTCAGG + Intronic
1060976420 9:127767817-127767839 ACTAAGGCTCAGAGAAGAAAAGG + Intronic
1061091403 9:128428568-128428590 ACTAAGGCCCAACAGGGAAAGGG - Intronic
1061141242 9:128768475-128768497 ACTGAGGCCCAGAGAGGAGATGG + Intronic
1061216433 9:129224549-129224571 ACTAGGGCCCAGAGGAGCGTTGG + Intergenic
1061238341 9:129354711-129354733 ACTGAGGCCCAGAGAGGTAAAGG - Intergenic
1061301650 9:129709168-129709190 ACCAAGGCCCAGAGGTGGGAAGG + Intronic
1061395079 9:130339417-130339439 GCTGAGGCCCAGAGTGGGAAGGG + Intronic
1061449870 9:130662146-130662168 ACCGAGGCCCAGAGAGGAAAGGG + Intergenic
1061488345 9:130931709-130931731 ACTGAGGCCCAGAGAGGGCAAGG + Intronic
1061502696 9:131012983-131013005 ACCAAGGCCCAGGGAGGCCACGG + Intronic
1061865320 9:133489115-133489137 GCTGAGGCCCAGGGTGGCAAGGG - Intergenic
1061894277 9:133639012-133639034 ACTGAGGCCCAGGGAGGCATTGG - Intronic
1061903550 9:133685073-133685095 ACCGAGGCCCAGGGAGGCAAAGG + Intronic
1062028228 9:134350339-134350361 ACTGAGGCTTGGAGGGGCAAAGG - Intronic
1062362530 9:136194430-136194452 ACTGAGGCCCAGAGGAGGAAAGG - Intergenic
1062428016 9:136514945-136514967 TCTGAGGCCCAGAGAGGCAGAGG + Intronic
1203630507 Un_KI270750v1:69179-69201 ACTGAGGCCTAGAGAGGGAAGGG - Intergenic
1185663276 X:1743919-1743941 AGTAAGCCCCACAAGGGCAAAGG - Intergenic
1186788112 X:12972021-12972043 ACAGAGGCACACAGGGGCAAAGG - Intergenic
1186884635 X:13901009-13901031 AATGAGGCTCAGAGAGGCAAAGG - Intronic
1187238087 X:17487198-17487220 ACTGAGGCCCAGAGAGGTTAAGG + Intronic
1187380055 X:18793778-18793800 AACAAGCCCCAGAGGGGCATGGG - Intronic
1188824699 X:34817470-34817492 ATTATTGCCCAGAGGTGCAATGG + Intergenic
1189143116 X:38627382-38627404 ACTAAGGCCAAGAGGGTAAGTGG - Intronic
1189429480 X:40934274-40934296 ACTAAGGCAGGGAGGGACAAGGG + Intergenic
1190733528 X:53240180-53240202 ACTAAGGCTCAGAGGGAGCATGG + Intronic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1191670682 X:63745624-63745646 ACTAAGGCACAGGAGGGGAAAGG - Intronic
1191791811 X:64979114-64979136 ACTGAGACCAAGAGAGGCAAAGG + Intronic
1192014911 X:67318939-67318961 AATAAGGCCCAGCGTGGTAAGGG + Intergenic
1192151700 X:68716767-68716789 ACTGAGGCCCAGAAGGGAAGAGG - Intronic
1192186058 X:68947554-68947576 ACTGAGGCCTAGAGTGTCAAAGG - Intergenic
1192203272 X:69080770-69080792 ACTGAGGCCCAGAGAGGTGAAGG - Intergenic
1192226755 X:69233983-69234005 ACTGAGGCCCAGAAAGGGAAAGG - Intergenic
1192226880 X:69234995-69235017 ACTGAGGCTCAGAGAGGCAGAGG - Intergenic
1192236359 X:69298676-69298698 ACTAAGGCCCAGGGGGAGGAAGG + Intergenic
1192779899 X:74283338-74283360 TTTAAAGCCCAGAGGGACAAGGG + Intergenic
1198805935 X:140494737-140494759 ACTGAGGCCCAGAGAGACACAGG - Intergenic
1200038801 X:153350742-153350764 ACTGAGGCCCACAGGGCAAAAGG - Exonic
1200247374 X:154533334-154533356 GCTGAGGCCCAGAGAGGCAATGG + Intronic
1200366929 X:155676469-155676491 ACTAAGGTCCAGAGAGGGGAAGG - Intergenic
1200373579 X:155755505-155755527 ACTGAGGCCAAGAGAGGTAAAGG - Intergenic
1202041129 Y:20685170-20685192 AATGACACCCAGAGGGGCAAAGG - Intergenic