ID: 1129452103

View in Genome Browser
Species Human (GRCh38)
Location 15:75656927-75656949
Sequence GAGCAGAGGACAGCGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452103_1129452110 10 Left 1129452103 15:75656927-75656949 CCCTCACACGCTGTCCTCTGCTC 0: 1
1: 0
2: 3
3: 28
4: 315
Right 1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG 0: 1
1: 0
2: 1
3: 0
4: 68
1129452103_1129452105 -10 Left 1129452103 15:75656927-75656949 CCCTCACACGCTGTCCTCTGCTC 0: 1
1: 0
2: 3
3: 28
4: 315
Right 1129452105 15:75656940-75656962 TCCTCTGCTCTGCCTATGCCAGG 0: 1
1: 0
2: 3
3: 34
4: 295
1129452103_1129452108 4 Left 1129452103 15:75656927-75656949 CCCTCACACGCTGTCCTCTGCTC 0: 1
1: 0
2: 3
3: 28
4: 315
Right 1129452108 15:75656954-75656976 TATGCCAGGCGCCTTCGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452103 Original CRISPR GAGCAGAGGACAGCGTGTGA GGG (reversed) Intronic