ID: 1129452104

View in Genome Browser
Species Human (GRCh38)
Location 15:75656928-75656950
Sequence AGAGCAGAGGACAGCGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452104_1129452110 9 Left 1129452104 15:75656928-75656950 CCTCACACGCTGTCCTCTGCTCT 0: 1
1: 0
2: 2
3: 42
4: 326
Right 1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG 0: 1
1: 0
2: 1
3: 0
4: 68
1129452104_1129452108 3 Left 1129452104 15:75656928-75656950 CCTCACACGCTGTCCTCTGCTCT 0: 1
1: 0
2: 2
3: 42
4: 326
Right 1129452108 15:75656954-75656976 TATGCCAGGCGCCTTCGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452104 Original CRISPR AGAGCAGAGGACAGCGTGTG AGG (reversed) Intronic