ID: 1129452106

View in Genome Browser
Species Human (GRCh38)
Location 15:75656941-75656963
Sequence GCCTGGCATAGGCAGAGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452106_1129452116 29 Left 1129452106 15:75656941-75656963 CCTCTGCTCTGCCTATGCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 1129452116 15:75656993-75657015 CATGAGTGACGAGGGCCGCATGG 0: 1
1: 0
2: 1
3: 5
4: 61
1129452106_1129452108 -10 Left 1129452106 15:75656941-75656963 CCTCTGCTCTGCCTATGCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 1129452108 15:75656954-75656976 TATGCCAGGCGCCTTCGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 50
1129452106_1129452114 21 Left 1129452106 15:75656941-75656963 CCTCTGCTCTGCCTATGCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 1129452114 15:75656985-75657007 AGCCAACGCATGAGTGACGAGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1129452106_1129452113 20 Left 1129452106 15:75656941-75656963 CCTCTGCTCTGCCTATGCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 1129452113 15:75656984-75657006 GAGCCAACGCATGAGTGACGAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1129452106_1129452110 -4 Left 1129452106 15:75656941-75656963 CCTCTGCTCTGCCTATGCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG 0: 1
1: 0
2: 1
3: 0
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452106 Original CRISPR GCCTGGCATAGGCAGAGCAG AGG (reversed) Exonic