ID: 1129452107

View in Genome Browser
Species Human (GRCh38)
Location 15:75656952-75656974
Sequence TTGGCGAAGGCGCCTGGCAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452107_1129452116 18 Left 1129452107 15:75656952-75656974 CCTATGCCAGGCGCCTTCGCCAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1129452116 15:75656993-75657015 CATGAGTGACGAGGGCCGCATGG 0: 1
1: 0
2: 1
3: 5
4: 61
1129452107_1129452113 9 Left 1129452107 15:75656952-75656974 CCTATGCCAGGCGCCTTCGCCAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1129452113 15:75656984-75657006 GAGCCAACGCATGAGTGACGAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1129452107_1129452114 10 Left 1129452107 15:75656952-75656974 CCTATGCCAGGCGCCTTCGCCAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1129452114 15:75656985-75657007 AGCCAACGCATGAGTGACGAGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1129452107_1129452118 30 Left 1129452107 15:75656952-75656974 CCTATGCCAGGCGCCTTCGCCAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1129452118 15:75657005-75657027 GGGCCGCATGGTGCAGGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 167
1129452107_1129452117 24 Left 1129452107 15:75656952-75656974 CCTATGCCAGGCGCCTTCGCCAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1129452117 15:75656999-75657021 TGACGAGGGCCGCATGGTGCAGG 0: 1
1: 0
2: 1
3: 9
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452107 Original CRISPR TTGGCGAAGGCGCCTGGCAT AGG (reversed) Exonic