ID: 1129452108

View in Genome Browser
Species Human (GRCh38)
Location 15:75656954-75656976
Sequence TATGCCAGGCGCCTTCGCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452103_1129452108 4 Left 1129452103 15:75656927-75656949 CCCTCACACGCTGTCCTCTGCTC 0: 1
1: 0
2: 3
3: 28
4: 315
Right 1129452108 15:75656954-75656976 TATGCCAGGCGCCTTCGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 50
1129452104_1129452108 3 Left 1129452104 15:75656928-75656950 CCTCACACGCTGTCCTCTGCTCT 0: 1
1: 0
2: 2
3: 42
4: 326
Right 1129452108 15:75656954-75656976 TATGCCAGGCGCCTTCGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 50
1129452106_1129452108 -10 Left 1129452106 15:75656941-75656963 CCTCTGCTCTGCCTATGCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 1129452108 15:75656954-75656976 TATGCCAGGCGCCTTCGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452108 Original CRISPR TATGCCAGGCGCCTTCGCCA AGG Exonic