ID: 1129452110

View in Genome Browser
Species Human (GRCh38)
Location 15:75656960-75656982
Sequence AGGCGCCTTCGCCAAGGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452106_1129452110 -4 Left 1129452106 15:75656941-75656963 CCTCTGCTCTGCCTATGCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG 0: 1
1: 0
2: 1
3: 0
4: 68
1129452103_1129452110 10 Left 1129452103 15:75656927-75656949 CCCTCACACGCTGTCCTCTGCTC 0: 1
1: 0
2: 3
3: 28
4: 315
Right 1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG 0: 1
1: 0
2: 1
3: 0
4: 68
1129452104_1129452110 9 Left 1129452104 15:75656928-75656950 CCTCACACGCTGTCCTCTGCTCT 0: 1
1: 0
2: 2
3: 42
4: 326
Right 1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG 0: 1
1: 0
2: 1
3: 0
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452110 Original CRISPR AGGCGCCTTCGCCAAGGTGA AGG Exonic
900265380 1:1754513-1754535 AGGCGCCTCGGCCTCGGTGAGGG - Intronic
908501324 1:64745641-64745663 AAGCGGCTTCTCCAAGGTCACGG + Intronic
917681012 1:177367421-177367443 AGGAGCCTTGACCAAGGAGAGGG + Intergenic
1074870532 10:117572304-117572326 AGGCACCTTCCTCCAGGTGAAGG + Intergenic
1075150191 10:119922198-119922220 AGAAGACTTCTCCAAGGTGATGG + Intronic
1075223541 10:120604548-120604570 AGGCTCCTTACCCAAGTTGATGG + Intergenic
1076437934 10:130459381-130459403 AGGGGTGTTCCCCAAGGTGAAGG + Intergenic
1076724819 10:132408419-132408441 AGGCGCCTTCACGATGGTGGTGG - Intronic
1078224614 11:9380580-9380602 AGCCTCCTTAGGCAAGGTGAAGG - Intergenic
1081157057 11:39705965-39705987 AAGAGCCTGAGCCAAGGTGATGG - Intergenic
1083463766 11:62832171-62832193 TGGCGCCTTAGCCAATGGGAGGG - Intergenic
1085784350 11:79437880-79437902 AGGCTCCTTCAGCAAGGTCAAGG + Intronic
1096611363 12:52804137-52804159 AGGTGCCTGAGCCAAAGTGATGG + Intergenic
1097699940 12:62809514-62809536 AGGGGCCTTCATCAAGGTTAGGG + Intronic
1105204881 13:18213147-18213169 ATGCCCTATCGCCAAGGTGATGG + Intergenic
1113326616 13:109288511-109288533 AGGCTGCTTCACAAAGGTGAAGG + Intergenic
1114414562 14:22532520-22532542 AGTCCCCTTCCCAAAGGTGAGGG - Intergenic
1121266187 14:92604081-92604103 AGGCGCCTTCCCCATTTTGAAGG - Intronic
1122206550 14:100150613-100150635 AGGCCCATTCTCCAAGGTCAGGG - Intronic
1129300453 15:74622519-74622541 AGGCACCTTTGGCAAGGTGGTGG + Exonic
1129452110 15:75656960-75656982 AGGCGCCTTCGCCAAGGTGAAGG + Exonic
1133720680 16:8491626-8491648 AGGTGCCTACACCAAGGTGGGGG + Intergenic
1140650591 16:77083885-77083907 AGAGGCCTTAGCCAATGTGATGG + Intergenic
1142348708 16:89570201-89570223 AGGCGCCAGCGCCAAGCAGAGGG + Intergenic
1143317073 17:6040919-6040941 AGGCGCCTTTTCCAAGGGGGTGG + Intronic
1144653461 17:17021084-17021106 AGGCTCCTTTGACAATGTGAAGG - Intergenic
1150025348 17:61668517-61668539 AAGAGCATTCACCAAGGTGATGG + Intergenic
1151426123 17:74032186-74032208 AGGAACCTTGGCCAAGGTCAGGG + Intergenic
1152645094 17:81465152-81465174 AGGGGCCTTCCCCAAGGGCAGGG - Exonic
1160488144 18:79312124-79312146 AGGTGCCTTCGCGGAGGTGCTGG + Intronic
1160549455 18:79684105-79684127 AGCCACCTTCACTAAGGTGATGG - Intronic
1160853844 19:1207084-1207106 AGGCTCTTACGGCAAGGTGAAGG + Exonic
1163157850 19:15449203-15449225 AGGCGCCCTCCCCAGGGAGATGG + Intronic
928243099 2:29603613-29603635 AGCCCCCTTGGCCAAGGGGAGGG + Intronic
928314053 2:30232381-30232403 AGCCGCCTTCGCCGTGCTGAAGG + Intronic
928651870 2:33412294-33412316 AAGCGCCTTTGCCAACCTGATGG - Intergenic
942898147 2:181083094-181083116 AGCTGCCTTCACCAAGGAGATGG + Intergenic
1173253251 20:41375561-41375583 AGGTGCCTGAGCCAGGGTGAAGG + Intergenic
1175448410 20:59042503-59042525 AGGCGCCCTAGCCGAGGGGACGG - Intronic
1180246362 21:46550595-46550617 AGGAGCCTTGGGCAAGGTGTTGG - Exonic
1180843627 22:18970402-18970424 AGGCGCCTGCGCCCAGGTGAGGG + Intergenic
1181895084 22:26100011-26100033 AGGTGCCTTCACCAGTGTGAAGG - Intergenic
1182137384 22:27918940-27918962 AGCCGCCTTCGCCCCGGGGAAGG + Intronic
1182656205 22:31892201-31892223 AGATGCCTTGGCCAAGATGATGG - Intronic
1184015332 22:41781742-41781764 ATCTGCCTTTGCCAAGGTGAGGG - Exonic
950457241 3:13100018-13100040 AGGCTCCTGCGCCAGAGTGAAGG - Intergenic
954800814 3:53186012-53186034 AGGCAGCTTCGGGAAGGTGAGGG + Exonic
970500922 4:16676425-16676447 AAGCCCCTTCGCCAAGATCACGG + Intronic
973641943 4:52911957-52911979 AGAGGCCATCGCCAGGGTGATGG - Intronic
981088508 4:140708687-140708709 AGGCACCATAGCCAATGTGAAGG + Intronic
989379314 5:40798063-40798085 CGGCACCTTCGGCAAAGTGAAGG - Exonic
996676586 5:126182185-126182207 CGGTGACTTCACCAAGGTGATGG - Intergenic
1001429776 5:171650145-171650167 AGGTGCCTTGGCCATGGTGGTGG + Intergenic
1002638531 5:180619731-180619753 CGGCGCCTTCGGGAAGGTGGTGG - Exonic
1003831206 6:10013806-10013828 AAGCGCCTTCCCCAAGGGGTAGG - Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024157660 7:46640889-46640911 AATGGCCATCGCCAAGGTGATGG + Intergenic
1028016347 7:85719001-85719023 AGGAGGCTTAGCCAAGGAGAGGG + Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1030293055 7:107891274-107891296 CTGCTCCTTGGCCAAGGTGAGGG + Exonic
1035225121 7:157428488-157428510 AGCTGCCTTCACCAAGGAGAAGG - Intergenic
1035869964 8:3126916-3126938 AGGTGCCTTCACCTAGGAGACGG + Intronic
1036146123 8:6256453-6256475 AGTATACTTCGCCAAGGTGAAGG + Intergenic
1041350223 8:56940963-56940985 AGGCTTATTCGCCAAGGTTAAGG - Intergenic
1047219967 8:122911261-122911283 AGGGGGCTTTGCCAAGATGAGGG + Intronic
1048484208 8:134832108-134832130 ACGCGCCAGCGCCAGGGTGAGGG + Intergenic
1061385764 9:130288523-130288545 AGGCCCCTTGGCTAGGGTGAAGG - Intronic
1198078265 X:133214719-133214741 AGGTGCCAGCGCCAAGGGGAAGG + Intergenic