ID: 1129452112

View in Genome Browser
Species Human (GRCh38)
Location 15:75656971-75656993
Sequence GCGTTGGCTCTCCTTCACCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452112_1129452117 5 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452117 15:75656999-75657021 TGACGAGGGCCGCATGGTGCAGG 0: 1
1: 0
2: 1
3: 9
4: 76
1129452112_1129452114 -9 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452114 15:75656985-75657007 AGCCAACGCATGAGTGACGAGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1129452112_1129452113 -10 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452113 15:75656984-75657006 GAGCCAACGCATGAGTGACGAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1129452112_1129452121 28 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452121 15:75657022-75657044 ACGAGGCAGACGGCATTCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 31
1129452112_1129452118 11 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452118 15:75657005-75657027 GGGCCGCATGGTGCAGGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 167
1129452112_1129452116 -1 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452116 15:75656993-75657015 CATGAGTGACGAGGGCCGCATGG 0: 1
1: 0
2: 1
3: 5
4: 61
1129452112_1129452120 18 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452120 15:75657012-75657034 ATGGTGCAGGACGAGGCAGACGG 0: 1
1: 0
2: 0
3: 25
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452112 Original CRISPR GCGTTGGCTCTCCTTCACCT TGG (reversed) Exonic