ID: 1129452115

View in Genome Browser
Species Human (GRCh38)
Location 15:75656987-75657009
Sequence GGCCCTCGTCACTCATGCGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 30}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452115_1129452122 25 Left 1129452115 15:75656987-75657009 CCAACGCATGAGTGACGAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1129452122 15:75657035-75657057 CATTCGCAGGCGCTGCCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 30
1129452115_1129452118 -5 Left 1129452115 15:75656987-75657009 CCAACGCATGAGTGACGAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1129452118 15:75657005-75657027 GGGCCGCATGGTGCAGGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 167
1129452115_1129452120 2 Left 1129452115 15:75656987-75657009 CCAACGCATGAGTGACGAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1129452120 15:75657012-75657034 ATGGTGCAGGACGAGGCAGACGG 0: 1
1: 0
2: 0
3: 25
4: 311
1129452115_1129452124 29 Left 1129452115 15:75656987-75657009 CCAACGCATGAGTGACGAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1129452124 15:75657039-75657061 CGCAGGCGCTGCCGCGTGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1129452115_1129452123 28 Left 1129452115 15:75656987-75657009 CCAACGCATGAGTGACGAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1129452123 15:75657038-75657060 TCGCAGGCGCTGCCGCGTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1129452115_1129452121 12 Left 1129452115 15:75656987-75657009 CCAACGCATGAGTGACGAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1129452121 15:75657022-75657044 ACGAGGCAGACGGCATTCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452115 Original CRISPR GGCCCTCGTCACTCATGCGT TGG (reversed) Exonic