ID: 1129452116

View in Genome Browser
Species Human (GRCh38)
Location 15:75656993-75657015
Sequence CATGAGTGACGAGGGCCGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452107_1129452116 18 Left 1129452107 15:75656952-75656974 CCTATGCCAGGCGCCTTCGCCAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1129452116 15:75656993-75657015 CATGAGTGACGAGGGCCGCATGG 0: 1
1: 0
2: 1
3: 5
4: 61
1129452112_1129452116 -1 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452116 15:75656993-75657015 CATGAGTGACGAGGGCCGCATGG 0: 1
1: 0
2: 1
3: 5
4: 61
1129452109_1129452116 12 Left 1129452109 15:75656958-75656980 CCAGGCGCCTTCGCCAAGGTGAA 0: 1
1: 0
2: 0
3: 12
4: 49
Right 1129452116 15:75656993-75657015 CATGAGTGACGAGGGCCGCATGG 0: 1
1: 0
2: 1
3: 5
4: 61
1129452106_1129452116 29 Left 1129452106 15:75656941-75656963 CCTCTGCTCTGCCTATGCCAGGC 0: 1
1: 0
2: 2
3: 28
4: 295
Right 1129452116 15:75656993-75657015 CATGAGTGACGAGGGCCGCATGG 0: 1
1: 0
2: 1
3: 5
4: 61
1129452111_1129452116 5 Left 1129452111 15:75656965-75656987 CCTTCGCCAAGGTGAAGGAGAGC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1129452116 15:75656993-75657015 CATGAGTGACGAGGGCCGCATGG 0: 1
1: 0
2: 1
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452116 Original CRISPR CATGAGTGACGAGGGCCGCA TGG Exonic