ID: 1129452118

View in Genome Browser
Species Human (GRCh38)
Location 15:75657005-75657027
Sequence GGGCCGCATGGTGCAGGACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452112_1129452118 11 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452118 15:75657005-75657027 GGGCCGCATGGTGCAGGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 167
1129452115_1129452118 -5 Left 1129452115 15:75656987-75657009 CCAACGCATGAGTGACGAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1129452118 15:75657005-75657027 GGGCCGCATGGTGCAGGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 167
1129452111_1129452118 17 Left 1129452111 15:75656965-75656987 CCTTCGCCAAGGTGAAGGAGAGC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1129452118 15:75657005-75657027 GGGCCGCATGGTGCAGGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 167
1129452109_1129452118 24 Left 1129452109 15:75656958-75656980 CCAGGCGCCTTCGCCAAGGTGAA 0: 1
1: 0
2: 0
3: 12
4: 49
Right 1129452118 15:75657005-75657027 GGGCCGCATGGTGCAGGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 167
1129452107_1129452118 30 Left 1129452107 15:75656952-75656974 CCTATGCCAGGCGCCTTCGCCAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1129452118 15:75657005-75657027 GGGCCGCATGGTGCAGGACGAGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452118 Original CRISPR GGGCCGCATGGTGCAGGACG AGG Exonic