ID: 1129452120

View in Genome Browser
Species Human (GRCh38)
Location 15:75657012-75657034
Sequence ATGGTGCAGGACGAGGCAGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452112_1129452120 18 Left 1129452112 15:75656971-75656993 CCAAGGTGAAGGAGAGCCAACGC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1129452120 15:75657012-75657034 ATGGTGCAGGACGAGGCAGACGG 0: 1
1: 0
2: 0
3: 25
4: 311
1129452115_1129452120 2 Left 1129452115 15:75656987-75657009 CCAACGCATGAGTGACGAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1129452120 15:75657012-75657034 ATGGTGCAGGACGAGGCAGACGG 0: 1
1: 0
2: 0
3: 25
4: 311
1129452111_1129452120 24 Left 1129452111 15:75656965-75656987 CCTTCGCCAAGGTGAAGGAGAGC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1129452120 15:75657012-75657034 ATGGTGCAGGACGAGGCAGACGG 0: 1
1: 0
2: 0
3: 25
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452120 Original CRISPR ATGGTGCAGGACGAGGCAGA CGG Exonic