ID: 1129452553

View in Genome Browser
Species Human (GRCh38)
Location 15:75659092-75659114
Sequence GTCCTGGGTACCCAGCCCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129452546_1129452553 26 Left 1129452546 15:75659043-75659065 CCAGGGGAGGGAAGTGGGGGACT 0: 1
1: 0
2: 4
3: 37
4: 382
Right 1129452553 15:75659092-75659114 GTCCTGGGTACCCAGCCCTGCGG 0: 1
1: 0
2: 3
3: 34
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129452553 Original CRISPR GTCCTGGGTACCCAGCCCTG CGG Exonic
900087076 1:903904-903926 GTCCTGGGAACCCTGCACAGAGG + Intergenic
900242204 1:1622468-1622490 GTCCTGGGCCTCGAGCCCTGTGG + Intronic
900317864 1:2068384-2068406 TTCCTGGCCACCCAGCTCTGGGG + Intronic
900345377 1:2208042-2208064 GGCCTTGGTGTCCAGCCCTGGGG - Intronic
900525879 1:3128477-3128499 GTCCTGGGTGCGGAGCCATGCGG - Intronic
900830925 1:4964853-4964875 CTCCTGGGACACCAGCCCTGAGG - Intergenic
902800218 1:18824914-18824936 GTCCTTGTCACCCAGTCCTGAGG - Intergenic
903189488 1:21648876-21648898 CTCCTGGGAAGCCAGGCCTGGGG - Intronic
903336060 1:22625629-22625651 TTCCTGGGTGCCCAGCCCAATGG + Intergenic
903740729 1:25556988-25557010 GGCCTAGGTACCCAGCCTGGAGG + Intronic
904584368 1:31571649-31571671 GTCCTGGTGCCCAAGCCCTGAGG - Intergenic
906521134 1:46467553-46467575 GTCTTGGATCCCCAGCCCTGCGG - Intergenic
907238094 1:53065017-53065039 CTTCTGTGTACCCAGCCATGTGG - Intronic
910916990 1:92299408-92299430 GCCCCGGGAACCCAGGCCTGGGG + Intronic
913608350 1:120487522-120487544 TTCCTAGGTCCCCAGCCCTGTGG + Intergenic
913987316 1:143576576-143576598 TTCCTAGGTCCCCAGCCCTGTGG - Intergenic
914582852 1:149034315-149034337 TTCCTAGGTCCCCAGCCCTGTGG - Intronic
915080353 1:153347883-153347905 GCTCTGGGTATCCAGGCCTGGGG - Exonic
915081458 1:153355499-153355521 GTCCAGTGTCCCCAACCCTGAGG + Intergenic
915291506 1:154887375-154887397 GTCCTTGGCACCCAATCCTGTGG + Intergenic
915357729 1:155266018-155266040 GCCCTAGGTAACCAGGCCTGGGG - Intronic
915681556 1:157586413-157586435 CTCCTGGAGACCCAGCCCTCAGG - Exonic
915713709 1:157925083-157925105 CTCCTGGAGACCCAGCCCTCAGG + Intergenic
916641097 1:166729684-166729706 GTGCTGGGGGCCCAGGCCTGAGG - Intergenic
916943898 1:169704707-169704729 GTCCATGGTACCCAGCTCTGGGG + Exonic
918295993 1:183157937-183157959 GTCCTGGAGACCAAGCCCTGTGG + Intergenic
918318025 1:183339415-183339437 ACTCTGGGTACCCATCCCTGAGG - Intronic
919805274 1:201377728-201377750 GGCCTGGTGAGCCAGCCCTGCGG + Exonic
920623009 1:207567444-207567466 ATCCTGGGGACACAGCGCTGAGG - Intronic
920950303 1:210566404-210566426 GTCATGGGTATCCAGGCTTGAGG - Intronic
921954434 1:220967512-220967534 GTGCTGGGTGCCCTCCCCTGGGG + Intergenic
922322247 1:224498990-224499012 GGCATGGGTTCCCAGCCCTCTGG - Intronic
923217980 1:231867627-231867649 GTCTTGGGCACACAGCCCTGTGG + Intronic
924592236 1:245414558-245414580 GGCCTGGGTGCCGAGGCCTGGGG - Intronic
924609441 1:245561515-245561537 GTACTCAGTACCCAGCCCTAGGG - Intronic
1062856628 10:783044-783066 GTCTTGGGAGCCCAGCTCTGCGG - Intergenic
1066414866 10:35212632-35212654 CTTCTGGGTGCACAGCCCTGCGG - Exonic
1066417934 10:35238446-35238468 GTCCTGGGTTCCCTGGACTGTGG + Intergenic
1067080196 10:43208431-43208453 ATCCTGGGGACCCAGCCCACTGG + Intronic
1067410487 10:46060292-46060314 GTCTTGGGAAGCCAGCCCTGGGG - Intergenic
1067658622 10:48216917-48216939 GCCCTCAGTACCCAGGCCTGGGG - Intronic
1067767518 10:49098195-49098217 GTGCTGGGCACACAGCCCTCAGG + Intronic
1068555978 10:58459376-58459398 TTCCTGGGTCTCCAGCCCAGTGG + Intergenic
1069563748 10:69449926-69449948 GCCCTGGGAACCCAGGACTGGGG + Intergenic
1069605097 10:69733829-69733851 CCCCTGGGTGCCCTGCCCTGGGG + Intergenic
1069848837 10:71391883-71391905 GTCCTCGGCACCCAGCCCACAGG + Intergenic
1070553935 10:77513937-77513959 GTCCTGGGCAGGCAGCACTGCGG - Intronic
1070628472 10:78067830-78067852 GCCCTGGGAACCTAGCTCTGTGG + Intergenic
1070655863 10:78270769-78270791 GTCCAGGGGACACAGACCTGTGG - Intergenic
1072333922 10:94380511-94380533 GTCCTGGGTTCCCTTCACTGTGG - Intergenic
1073552344 10:104415089-104415111 GCCCTTGGTACACTGCCCTGTGG - Intronic
1074143339 10:110696283-110696305 GTCCTGGGTAAGAAGTCCTGGGG - Intronic
1074242778 10:111655381-111655403 GCCCTGAGTACCTAGACCTGGGG + Intergenic
1074437365 10:113445568-113445590 GTCCTGGGGAGCCAGCGCGGAGG - Intergenic
1074829841 10:117240899-117240921 GCCTTGGGGACCCAGGCCTGGGG - Intergenic
1076616478 10:131758686-131758708 TTGTTGGGTACACAGCCCTGGGG - Intergenic
1076687441 10:132204456-132204478 CTCCTGGGGACTCAGGCCTGGGG + Intronic
1077143065 11:1033367-1033389 GTGCAGGGTACTCATCCCTGGGG + Intronic
1077225444 11:1437359-1437381 GGCCTGGGGTCCCAGCCCTCAGG - Intronic
1077239329 11:1502450-1502472 GTCATGGGGGCCCAGGCCTGGGG - Intergenic
1077243369 11:1523717-1523739 TTCCTGGGGCCCCAGCCATGGGG + Intergenic
1077341723 11:2029202-2029224 GTCCTGGGAAGCCAGCCGAGTGG - Intergenic
1077443294 11:2578609-2578631 GTGCTGGGGCCCCAGCCATGAGG - Intronic
1077550201 11:3196819-3196841 GCCCTGGGAACCCTGCCCAGTGG + Intergenic
1079446233 11:20558618-20558640 GTCCTGGGTAGCCAGCACCTTGG + Intergenic
1080205736 11:29726484-29726506 GTCCTGGGTTCCCAGATCTGTGG + Intergenic
1081420710 11:42873074-42873096 GTCCTGGGTTTCCAGGCTTGGGG - Intergenic
1083201398 11:61123121-61123143 GTCCTGCGTGCCCAGCTCTCTGG - Intronic
1083316034 11:61815621-61815643 GTCCTGGGGACTCAGTCCTAGGG - Intronic
1084009200 11:66338376-66338398 GTCCTGGGGGCACAGCACTGAGG - Intronic
1084696273 11:70757442-70757464 GGCCGGGACACCCAGCCCTGCGG + Intronic
1084964820 11:72739060-72739082 GGGCTGGGTTCCCAGCCCAGAGG + Intronic
1088710524 11:112504258-112504280 TTGCTGTGTAACCAGCCCTGGGG + Intergenic
1089254747 11:117188336-117188358 TTCAAGGGTGCCCAGCCCTGTGG - Intronic
1091154493 11:133361060-133361082 GCCCTGGGTCCCCAGCCCCAAGG + Intronic
1202824709 11_KI270721v1_random:84391-84413 GTCCTGGGAAGCCAGCCGAGTGG - Intergenic
1091805732 12:3354693-3354715 CTCATGGTTACCCAGCCCTCTGG - Intergenic
1092112237 12:5971777-5971799 CTCCTGCGTACTGAGCCCTGGGG + Intronic
1092230547 12:6773404-6773426 GTCCTCTGTCCCCTGCCCTGAGG + Intronic
1092664690 12:10782919-10782941 GTCCTAGCTACCTAGCCCTCAGG - Intergenic
1096154680 12:49335332-49335354 GTTCTAGGCCCCCAGCCCTGGGG + Intronic
1096477498 12:51917384-51917406 GCCCTGGGCAGGCAGCCCTGAGG + Intronic
1096868864 12:54580915-54580937 GACCTGGCAGCCCAGCCCTGGGG + Intronic
1101968430 12:109296231-109296253 TTCCTGCGCACCCAGCGCTGGGG + Intronic
1104987243 12:132603970-132603992 GTCCTGGGTCCCCCTCCCCGCGG + Intronic
1104993170 12:132637978-132638000 GTCCTGGTGACGCAGCACTGTGG - Intronic
1105817170 13:24047112-24047134 GTCCTGTGGACCCCGCCTTGAGG - Intronic
1106182576 13:27381503-27381525 GGCCTGGGTACCTGGCCGTGGGG + Intergenic
1106572176 13:30936695-30936717 CTCCCGTGGACCCAGCCCTGTGG - Intronic
1108156671 13:47592309-47592331 GTCCAGGGTACCCTGCCCAATGG + Intergenic
1111092147 13:83461932-83461954 GTCCTGGTTACCACTCCCTGGGG - Intergenic
1111665397 13:91261384-91261406 GTGCTTGGTACCCTGCCCTCAGG + Intergenic
1112050400 13:95639914-95639936 GTCTTGGGTAGACAACCCTGAGG - Intronic
1112271724 13:97975934-97975956 GCCCTGAGTCCACAGCCCTGGGG + Intronic
1113634450 13:111910124-111910146 GTTCTGGGTACCTGGACCTGAGG - Intergenic
1113870875 13:113559293-113559315 GTCCTGAGAACCCAGGGCTGGGG + Intergenic
1114430537 14:22656883-22656905 AGCCTGGGGCCCCAGCCCTGTGG - Intergenic
1117070486 14:52051510-52051532 GTACTAAGTACCCAGCCATGTGG - Intronic
1117575467 14:57092863-57092885 GCCCTGGGCACCCAGCACTGAGG + Intergenic
1118350780 14:64971651-64971673 GGCCTGGGTACCCCGAGCTGGGG - Intronic
1119525703 14:75320741-75320763 TTGCTGGGTACCCACACCTGGGG + Intergenic
1119767876 14:77201836-77201858 GTCCTGGGGGCCCAGCCCCAGGG - Intronic
1119859251 14:77924616-77924638 GCCTTTGTTACCCAGCCCTGGGG + Intronic
1121172761 14:91868450-91868472 GCCATGGGTACCCAGGCTTGAGG + Intergenic
1121432178 14:93895343-93895365 GTTCTTGGTACCTAGCCCAGTGG + Intergenic
1121441076 14:93949807-93949829 GTCCTGGGAGCCCAGGCCGGGGG - Intronic
1121672994 14:95727447-95727469 GGCCTGGGTCCACAGGCCTGAGG + Intergenic
1122093238 14:99353539-99353561 GGCCTTGAGACCCAGCCCTGGGG - Intergenic
1122986743 14:105215021-105215043 GTGGGGGGTCCCCAGCCCTGAGG + Intronic
1123111378 14:105868554-105868576 GGCCTGGGTACTCTGCTCTGGGG + Intergenic
1123679140 15:22745185-22745207 GGCCGGGGTCCCCAGTCCTGGGG + Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1124331359 15:28819635-28819657 GGCCGGGGTCCCCAGTCCTGGGG + Intergenic
1125362264 15:38876590-38876612 GTGCTGGGAACCAAGACCTGTGG - Intergenic
1125930287 15:43594966-43594988 GGTCTGGGTACTCAGCGCTGGGG - Exonic
1125943455 15:43694798-43694820 GGTCTGGGTACTCAGCGCTGGGG - Exonic
1126704927 15:51397766-51397788 GTCCCTGGTCCTCAGCCCTGGGG - Intronic
1128145606 15:65330937-65330959 GTGCAGGGTGCCCGGCCCTGAGG - Intronic
1129004279 15:72359103-72359125 GTCCTGATTTCCCAGCCCTCTGG - Intronic
1129109833 15:73330849-73330871 GACCTGGGTTCCCAGCCTTGGGG + Intronic
1129205033 15:74032506-74032528 GTCTGGGGTACCTGGCCCTGGGG + Intronic
1129452553 15:75659092-75659114 GTCCTGGGTACCCAGCCCTGCGG + Exonic
1129680502 15:77656067-77656089 CCCCTGAGTGCCCAGCCCTGTGG - Intronic
1131213985 15:90521733-90521755 AGCCTGGGTCCCCAGCACTGGGG - Intergenic
1132695998 16:1202264-1202286 GTTCATGGTGCCCAGCCCTGTGG - Exonic
1132810365 16:1794103-1794125 GGCCTGAGTAGCCAGCCGTGTGG + Intronic
1134099894 16:11444696-11444718 CTACTGTGTACCAAGCCCTGTGG + Intronic
1134207918 16:12252771-12252793 GCTCTGGGCACCCAGCCATGGGG + Intronic
1136283566 16:29228604-29228626 CTGCTGTGTGCCCAGCCCTGGGG + Intergenic
1137787988 16:51152639-51152661 CCCCTGGGCACCCCGCCCTGGGG + Intergenic
1138346710 16:56324660-56324682 GACCTGGAAAGCCAGCCCTGGGG - Intronic
1138481759 16:57307804-57307826 CTCCTGGGCACCCAGCACTAAGG + Intergenic
1138977873 16:62230272-62230294 GCCCTGGGTATCCAGGCTTGAGG - Intergenic
1139574517 16:67832645-67832667 TTTCTGGGTCCCTAGCCCTGAGG - Intronic
1139905755 16:70364668-70364690 GTCCTAGGTTGCCTGCCCTGGGG + Intronic
1140601244 16:76477485-76477507 ATCCTGGGCTCCCAGCTCTGGGG + Intronic
1141126025 16:81401714-81401736 GTCCTGGGTGCCCAGGACAGTGG - Intergenic
1141722254 16:85763035-85763057 GGCCTGGGCACCGTGCCCTGGGG + Intergenic
1142088597 16:88198115-88198137 CTGCTGTGTGCCCAGCCCTGGGG + Intergenic
1142168976 16:88610467-88610489 TTCCAGGGTACCCTGCCCAGGGG - Intronic
1143544543 17:7588643-7588665 GCCCTGGCTACCCAGCCCGCTGG + Intronic
1143814632 17:9502280-9502302 GGAGTGGTTACCCAGCCCTGGGG + Intronic
1145963388 17:28900759-28900781 AGCCTGGGTCCTCAGCCCTGGGG - Intronic
1146666713 17:34710016-34710038 GTCATGGGAACCCAGGCTTGGGG - Intergenic
1147159568 17:38562353-38562375 GTCCTTGGTGACCAGCCCCGTGG - Intronic
1147166544 17:38596452-38596474 GTCCTGGGAACCCAGTTCTGGGG - Intronic
1147439131 17:40436722-40436744 GTCCTGTTTCCCCAACCCTGAGG - Intergenic
1147774597 17:42891766-42891788 CTCCTAGGTCCCCAGGCCTGGGG - Intergenic
1150220834 17:63495113-63495135 GTCCTGGCCACCCCTCCCTGAGG - Intronic
1150387791 17:64774632-64774654 ATCCTGCGTGCCCAGCCCTGTGG - Intergenic
1150442002 17:65198685-65198707 TTGCTCAGTACCCAGCCCTGGGG + Intronic
1151322241 17:73359100-73359122 CTACTGTGTACCCAGCTCTGGGG - Intronic
1151380067 17:73719708-73719730 GCCCTGGGCCCCCAGGCCTGTGG + Intergenic
1151815884 17:76471193-76471215 ATGGTGGGCACCCAGCCCTGGGG + Exonic
1152311657 17:79555013-79555035 GTTCTGGCTGCCCTGCCCTGTGG - Intergenic
1152785449 17:82245662-82245684 GTCCTGGGTGCCCACCCGTGAGG - Intronic
1152885070 17:82844944-82844966 GGCCGAGGTACCCAGCCCAGAGG + Intronic
1153802400 18:8682786-8682808 GTCCTGGGCTCACAGCCCTGAGG + Intergenic
1157428581 18:47604445-47604467 GTCCTGCCTTCCCAGCCCTGAGG - Intergenic
1158589561 18:58768402-58768424 GTCCTGGCCACCTAGCCCAGAGG + Intergenic
1159586466 18:70288472-70288494 GTCCTGGGGTCCCCTCCCTGCGG + Intergenic
1159877888 18:73831449-73831471 TTCAAGGGTACTCAGCCCTGAGG - Intergenic
1159895566 18:73992455-73992477 GTCATGGCTACCCATCCTTGAGG - Intergenic
1160864972 19:1252425-1252447 GGCGGGGGTGCCCAGCCCTGGGG + Intronic
1161271191 19:3390231-3390253 CACCTGGCTGCCCAGCCCTGGGG - Intronic
1161952677 19:7476647-7476669 GTCCTGGGCACACAGGCCAGAGG - Intergenic
1162143826 19:8600890-8600912 TCCCTGGGCACGCAGCCCTGAGG - Intronic
1162381944 19:10336408-10336430 TTCCTGGTTCACCAGCCCTGTGG + Intronic
1162621620 19:11848627-11848649 GCCCTGGGTATCAGGCCCTGCGG - Intergenic
1163012395 19:14433912-14433934 CTGCCGGGTACCCAACCCTGGGG - Intronic
1163036418 19:14571804-14571826 GCCCTGGGGTGCCAGCCCTGGGG + Intronic
1163361219 19:16847438-16847460 TGCCTGGGACCCCAGCCCTGTGG + Intronic
1164477993 19:28590011-28590033 CTCCTGTGTACCGGGCCCTGTGG - Intergenic
1165139148 19:33688754-33688776 GTCCCTGGTACCCGGCCCGGTGG - Intronic
1165604940 19:37093786-37093808 TTACTGGTTACCCAGCACTGGGG + Intronic
1166096472 19:40542440-40542462 GTCCTGGCTCCCCAGCCCTCAGG + Intronic
1166262387 19:41649646-41649668 GGCCAGGGTACTCAGCCCGGTGG + Intronic
1166293748 19:41878990-41879012 GCCCTGGGTGCCAGGCCCTGTGG + Exonic
1166501339 19:43343757-43343779 GTCCAGGGTGCCCTTCCCTGAGG + Intergenic
1167156771 19:47743385-47743407 GGCCTGGGAACCAAGCCCTGGGG + Intergenic
1167614787 19:50526433-50526455 CTCCAGGGAACCCAGCCCCGGGG - Intronic
927096452 2:19751015-19751037 TTCCTGGGTACCCACCCCACTGG + Intergenic
927152918 2:20205941-20205963 GTCCTCGGTATCCACACCTGGGG - Intronic
927575909 2:24201634-24201656 GTCCTGTGTTCCCAGGGCTGCGG - Intergenic
929230824 2:39558016-39558038 CTCCTGGGTATCCAGCTCTTGGG - Intergenic
930220002 2:48736528-48736550 CTCCTGGGTACCCAGGATTGGGG + Intronic
932435359 2:71700045-71700067 GACCTGGGTCCCCTGCCCTGGGG - Intergenic
932693484 2:73933738-73933760 ATCCTGGGTACTCAGTCTTGGGG + Intronic
933356711 2:81219385-81219407 GTCCTGGGTATACACCCCAGTGG - Intergenic
933407633 2:81881342-81881364 CTCCTGGGAACCCAGCCCAGAGG - Intergenic
935050473 2:99521035-99521057 CTTCTGAGTACCCGGCCCTGTGG + Intergenic
935194106 2:100801351-100801373 CTCCTTGGTACCCAGCTCTGTGG + Intergenic
937150610 2:119683281-119683303 GTCCTAGGTACCAGGGCCTGGGG - Intronic
938647943 2:133350701-133350723 GTCCTGCCTACACAGACCTGTGG + Intronic
939965272 2:148604645-148604667 GTGCTGGGTACAGAGCCCTCTGG + Intergenic
940323210 2:152399134-152399156 GTGCTGGGATCCCAGACCTGAGG + Intronic
944977951 2:205078942-205078964 GTCATGGATGCCCAGACCTGTGG + Intronic
946671467 2:222109518-222109540 GTCCTGGGTACCAAGACTGGAGG - Intergenic
947815694 2:233034768-233034790 GGCCTGGCTCCCCAGCCCAGTGG + Exonic
947992392 2:234497432-234497454 GTCCCGGGGTCCCAGCTCTGTGG + Intergenic
948653280 2:239462308-239462330 GCCCTGGGTTCTGAGCCCTGGGG + Intergenic
948726288 2:239936031-239936053 GTTCAGGCTGCCCAGCCCTGGGG - Intronic
948783785 2:240340517-240340539 GCAGTGGGGACCCAGCCCTGTGG - Intergenic
948992023 2:241560153-241560175 GTTTTGGCTACCCAGCCCGGTGG - Intronic
1169263179 20:4152327-4152349 CTGCTGGGTACCCAGCCCTGGGG + Intronic
1169280282 20:4261389-4261411 GTCCTGGGTCCCCAGCCTGATGG + Intergenic
1169415788 20:5415147-5415169 GGTCTGGCTACCCCGCCCTGTGG + Intergenic
1171986522 20:31665051-31665073 GTTCAGGGGACTCAGCCCTGAGG - Exonic
1172167310 20:32907160-32907182 TACCTGGGAACCCAGCTCTGGGG - Intronic
1173209032 20:41017509-41017531 TTCCTGGCTTTCCAGCCCTGAGG + Intergenic
1173769841 20:45647215-45647237 CTCCTGTGTACCCAGGCATGAGG - Intergenic
1174329349 20:49805676-49805698 GTTCTGAGTCACCAGCCCTGTGG + Intergenic
1174395985 20:50247186-50247208 ATCCTGGGGACCCAGCCCAGGGG + Intergenic
1175491108 20:59381723-59381745 TTCCTGGGCACCCATCCCTAGGG - Intergenic
1175901535 20:62361744-62361766 GGCCCGGGTACCCAGCCTTGAGG - Intronic
1176051345 20:63121046-63121068 GCCTTGGGTATCCAGCCCTGGGG + Intergenic
1176071007 20:63226473-63226495 TTCCTGGGAACCCAGGCCTGAGG + Intergenic
1176086343 20:63297221-63297243 GTCCTGGGGACCCAGCCCAGGGG + Intronic
1176190923 20:63809228-63809250 GCCCTGGGGGCGCAGCCCTGGGG + Intronic
1177045674 21:16166115-16166137 CTCGTGGGCACCCATCCCTGTGG + Intergenic
1178293196 21:31386970-31386992 GCCATGGGTGCCCAGCCCAGCGG - Intronic
1179233247 21:39524163-39524185 GAGCTGGGTACCCAGCCTTGTGG - Intergenic
1179802968 21:43820150-43820172 GTTCTGGGGTCCCACCCCTGAGG + Intergenic
1179822122 21:43943017-43943039 ACCCTGGCCACCCAGCCCTGGGG - Intronic
1179979996 21:44890890-44890912 GTCCTGGGTGTGCAGCCCTGGGG - Intronic
1180148826 21:45937279-45937301 GTCCAGGGGCCCCAGCCCTTTGG + Intronic
1180924460 22:19544243-19544265 GACCTGGGTGCCAAGTCCTGAGG - Intergenic
1181027887 22:20136096-20136118 GTCCAGGGGGCCCAGCCCCGAGG - Intronic
1181032521 22:20155251-20155273 GCCCTGGATCCCCATCCCTGGGG + Intergenic
1181455670 22:23058948-23058970 GTCCTGAGCACTCATCCCTGGGG + Intergenic
1181510903 22:23388362-23388384 GCCCTGGATCCCCAGCCCTGGGG - Intergenic
1182738247 22:32546609-32546631 GCACTGGGGACACAGCCCTGAGG + Intronic
1183209392 22:36441556-36441578 GCCCTGAGCTCCCAGCCCTGTGG - Intergenic
1183530718 22:38351900-38351922 GTCCTGCATACACAGCCCAGTGG - Intronic
1183589083 22:38769554-38769576 ATCCTGGGTCCCCAGACTTGAGG + Intronic
1183948027 22:41337836-41337858 GTGCTGGGTCCTCACCCCTGTGG - Intronic
1184240014 22:43207052-43207074 GTCCTGGGTCCCCAGGCCTCTGG + Intronic
1184376966 22:44119682-44119704 ATCCCTGGTACCCAGCCCTCGGG - Intronic
1185053839 22:48567734-48567756 GTTCTGGGTACCCTGGGCTGTGG + Intronic
1185140048 22:49095130-49095152 GTGGTGGGCACCCAGCCCCGAGG + Intergenic
1185144030 22:49119731-49119753 GTCCTGAGAACCAAGCCCCGCGG + Intergenic
949260380 3:2098384-2098406 TTCCTGGGTACCCAAACCTCTGG - Intergenic
950039889 3:9913700-9913722 GTCCTCTGTGCCAAGCCCTGAGG - Intronic
950108333 3:10402482-10402504 TGTCTGGGTACCAAGCCCTGTGG + Intronic
950550823 3:13664906-13664928 GTCCTCAGCACCCTGCCCTGGGG - Intergenic
952788128 3:37176172-37176194 GTCCTGGGTCCCCGGCCAGGCGG + Intronic
952861205 3:37814114-37814136 GTCCTGAGTACCCAGCTGTGTGG + Intronic
960159037 3:114329570-114329592 CTCTTGGGTATCCAGCCCTCAGG - Intergenic
961056008 3:123789425-123789447 GTCCTGGGTGCCCAGCACATGGG + Intronic
961743880 3:129051046-129051068 GTACTGAGTGCCAAGCCCTGAGG + Intergenic
965504122 3:169493188-169493210 TTGCTGGGTACCAAGCACTGGGG + Intronic
967043677 3:185717170-185717192 GACCGGGGTGCCCAGCCCTCAGG - Exonic
968501722 4:953255-953277 GTCGTCGGTACAGAGCCCTGTGG - Exonic
968646092 4:1741342-1741364 GCCCTGGGTCCCCAACCCTTGGG - Intronic
968698033 4:2042210-2042232 GTCCAGGGCTCCCAGGCCTGGGG + Intronic
968866703 4:3217517-3217539 GGCCTTGGTTCCCAGCCCTCTGG - Intronic
969098068 4:4749235-4749257 GGCCTGAATTCCCAGCCCTGTGG - Intergenic
969167570 4:5329969-5329991 ATCCTGGGTGTGCAGCCCTGGGG - Intronic
969244652 4:5924591-5924613 GCCCTGGGTTCTCAGCACTGAGG - Intronic
969323500 4:6427147-6427169 GTCCTGGCCTCCCAGCCCAGTGG - Intronic
970093027 4:12430995-12431017 GTCCTGATTTCTCAGCCCTGAGG + Intergenic
970234015 4:13940253-13940275 GTCCTGGGAACCCCACCTTGAGG - Intergenic
971326910 4:25652226-25652248 GCCCAGGGTACCCACCCCTGAGG - Intergenic
971917417 4:32890808-32890830 AACCTGGGTCCCCAGCCCTTGGG - Intergenic
972556475 4:40186561-40186583 GTCAGGGGTCCCCAGTCCTGGGG - Intergenic
977465384 4:97378040-97378062 ATCCTGGCTTCCCAGCCCTCTGG - Intronic
985650122 5:1103730-1103752 GTCCTGGGCACCCCGCCCCGTGG - Intronic
985767371 5:1787102-1787124 TTCGTGGGTAGCCTGCCCTGCGG + Intergenic
986800949 5:11259443-11259465 ATCCTGGACATCCAGCCCTGTGG + Intronic
987271525 5:16314449-16314471 GCCCTGGGTATCCAGGCTTGGGG - Intergenic
989176096 5:38527973-38527995 GTCCTAAGCACCCAGCCCTAAGG - Intronic
989719254 5:44504834-44504856 GCCCTGGGTAATAAGCCCTGAGG - Intergenic
991604642 5:68388585-68388607 GTCCTGGGAAAGCATCCCTGGGG + Intergenic
996247066 5:121277649-121277671 TGCCTTGGTACTCAGCCCTGTGG - Intergenic
998137513 5:139681948-139681970 GTGCTGGGTGCCCTGCTCTGAGG + Intronic
998147471 5:139738399-139738421 GCCCTGAGAACACAGCCCTGAGG - Intergenic
1001228994 5:169969718-169969740 GTCCTGGTTACCTAGGACTGAGG + Intronic
1002057329 5:176606012-176606034 GCCCTGGAAGCCCAGCCCTGGGG + Intronic
1004518290 6:16339224-16339246 GTCCTGGAAACCCAGCCCCCTGG - Intronic
1006429698 6:33988163-33988185 GTCCTGGGACCCAGGCCCTGTGG + Intergenic
1006512864 6:34531042-34531064 GACCGGGGTCCCCAACCCTGGGG - Intronic
1007079216 6:39086822-39086844 CACCGGGGAACCCAGCCCTGGGG + Exonic
1011262316 6:85482519-85482541 GTCCTGGGAACCAAGGACTGTGG - Intronic
1011603031 6:89077683-89077705 GTCATTGGTAGCCAGCTCTGTGG - Intergenic
1011640585 6:89412728-89412750 GTCCTGGGCACGCTGCTCTGGGG - Intergenic
1013084445 6:106844065-106844087 GTCCTGGGCAACCAGGCTTGTGG + Intergenic
1015181589 6:130366500-130366522 GTCCTGAGCACCGGGCCCTGGGG - Intronic
1017879208 6:158548054-158548076 GCCCTGGGGAGCCAGGCCTGTGG - Intronic
1018043891 6:159949406-159949428 GTCCTGGGTTCCCTTCACTGTGG - Intergenic
1018841902 6:167523498-167523520 GTCCTGGGAACCCAGGACAGAGG + Intergenic
1018928489 6:168223345-168223367 CTCCTGGGGACCCAGTTCTGGGG - Intergenic
1019689754 7:2403905-2403927 GCCAGGGGGACCCAGCCCTGGGG + Intronic
1019724075 7:2591301-2591323 GCCCTGCCTTCCCAGCCCTGTGG - Intronic
1020010592 7:4803857-4803879 GCCCTGAGTCCCCTGCCCTGTGG + Intronic
1021081446 7:16370267-16370289 GATCTGGGTGCCCAGCCTTGTGG + Intronic
1027247940 7:76379929-76379951 GCCCTGGGCACGGAGCCCTGCGG - Intergenic
1030620625 7:111786313-111786335 CTGCTGGATCCCCAGCCCTGGGG + Intronic
1033719056 7:144037589-144037611 GTCCTGGTTACACAGCTGTGGGG - Intergenic
1035078834 7:156199444-156199466 TTCCTGGGGAGCCTGCCCTGTGG + Intergenic
1035737758 8:1901134-1901156 GCCCTGAGTACCCACACCTGAGG - Intronic
1036119205 8:5997034-5997056 GCCCTGGATCCACAGCCCTGGGG + Intergenic
1039647816 8:39306271-39306293 GCCCTGGGTATCCAGCCCTGAGG + Intergenic
1041291339 8:56311151-56311173 GTCCTGTGATCCCAGCACTGTGG + Intronic
1041394997 8:57381111-57381133 GTCCAGGGCACCCAGGCCTGAGG - Intergenic
1042210497 8:66375952-66375974 GTCTTGTGTAAACAGCCCTGGGG + Intergenic
1044821104 8:96156505-96156527 GCCCTGGACCCCCAGCCCTGGGG - Intronic
1045362670 8:101447783-101447805 ATCTTGGGTGCTCAGCCCTGTGG + Intergenic
1046004686 8:108464575-108464597 GTCCTCCGTACCAACCCCTGGGG - Intronic
1048517080 8:135120877-135120899 TTCCTCTGTGCCCAGCCCTGGGG + Intergenic
1049658294 8:143808542-143808564 CTCCTGGGCACCCAGGGCTGCGG - Intronic
1055285159 9:74720863-74720885 GTTCTGTGTACCCACCCATGTGG + Intergenic
1055481003 9:76709175-76709197 GTCCTGGGAACCTAGACATGTGG - Exonic
1057758139 9:97853267-97853289 GGCGTGGGTCTCCAGCCCTGCGG - Exonic
1058859616 9:109102907-109102929 CTTCTGGTTACCCAGCCGTGTGG - Intronic
1060221188 9:121764934-121764956 TTCCTGTGTGCCCAGTCCTGAGG - Intronic
1060545162 9:124455001-124455023 GCTCTGGGTCCCCAGCCCCGAGG - Exonic
1061056278 9:128224574-128224596 TCCCTGGGTCCCCAGACCTGGGG - Intronic
1061238516 9:129355914-129355936 GTTTTGGGCACCCAGCCCAGTGG - Intergenic
1061379173 9:130243870-130243892 GCCCTGGGGACCCCTCCCTGGGG - Intergenic
1062057462 9:134475917-134475939 GTCCGGGGTCTCCAGCTCTGAGG - Intergenic
1062429179 9:136519404-136519426 GCCCCGGCTACCCCGCCCTGCGG + Intronic
1185507693 X:642570-642592 CTCCTGGGTACCTGGCCTTGAGG + Intronic
1186888477 X:13938216-13938238 CTCCCGGGTACCCAGCTCTTAGG + Intronic
1187650979 X:21406011-21406033 GCCCAGGGTCCCCAGCCCTTGGG + Intronic
1189165656 X:38858300-38858322 GTCCTGATTACTCTGCCCTGGGG + Intergenic
1190303908 X:49071845-49071867 GTCCTGGGTACAGATCCCAGGGG + Exonic
1190708590 X:53049627-53049649 CTCCTTGGTACCCAAGCCTGGGG + Intronic
1190756197 X:53404103-53404125 TTACTGTGTCCCCAGCCCTGTGG - Intronic
1192522422 X:71814454-71814476 GTCTTGGGTAGACAGCCCTGCGG - Intergenic
1199628871 X:149762451-149762473 GTCCGCGGTACCAAGCCCGGAGG + Intergenic