ID: 1129453132

View in Genome Browser
Species Human (GRCh38)
Location 15:75661833-75661855
Sequence TTTCCCCTCTAGATGAGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129453131_1129453132 0 Left 1129453131 15:75661810-75661832 CCAAAGGAAGAAGGGGAGGCAGA 0: 1
1: 0
2: 8
3: 72
4: 518
Right 1129453132 15:75661833-75661855 TTTCCCCTCTAGATGAGTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129453132 Original CRISPR TTTCCCCTCTAGATGAGTGA AGG Exonic
908000237 1:59672188-59672210 CTTCCCCTCTGGATGGTTGATGG + Intronic
908335306 1:63116619-63116641 ATTCCCCTCTAGGTCAGTGAGGG + Intergenic
908829435 1:68164615-68164637 TATCCCCTCTATAGGAGTGTAGG - Intronic
908889448 1:68827193-68827215 TGTCATCTCTAGATGAGTGTAGG + Intergenic
911126225 1:94343475-94343497 TATCCCCTCAAAATGATTGATGG - Intergenic
912759351 1:112353242-112353264 ATTCCCCTCTACTTGAGTGTGGG - Intergenic
913216706 1:116626998-116627020 TTTCCCCTCTAGAAAATAGAAGG - Intronic
913681725 1:121192332-121192354 TTTTCCCACAAGATGATTGAGGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922552497 1:226506315-226506337 CTTCCCCTCTATATTAGTCAGGG + Intergenic
922911491 1:229221494-229221516 TTCCTCCTCTAGGTGAGTGTGGG - Intergenic
923553243 1:234980692-234980714 TGACCCCTTTGGATGAGTGAGGG - Intergenic
923888164 1:238180833-238180855 GTTATCCTCTAGATGACTGATGG + Intergenic
923982000 1:239335364-239335386 TTTGGCCATTAGATGAGTGAAGG + Intergenic
1066761648 10:38760089-38760111 TATTCCCTTTAGATGAATGATGG - Intergenic
1066959943 10:42212332-42212354 TATTCCCTTTAGATGAATGATGG + Intergenic
1069250157 10:66257138-66257160 TTCATCCTCTAGATGACTGATGG + Intronic
1069512269 10:69051300-69051322 TCTCGCCTCTAGAACAGTGAGGG - Intergenic
1071830207 10:89363932-89363954 TTTCCCCTTTCAATGTGTGAAGG - Intronic
1072889281 10:99307461-99307483 CTTCTCCTCCACATGAGTGATGG - Intergenic
1074025943 10:109635115-109635137 TTTCCTCTCTCGAAGAATGAAGG + Intergenic
1074708254 10:116155345-116155367 TTCCCCCTCTAGCAGAGGGAAGG + Intronic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087034047 11:93738435-93738457 TCTCCCCTTTAGGTGAGTAAGGG + Exonic
1088426355 11:109708750-109708772 TTTCACAGCTAGATGAGTGTAGG - Intergenic
1089135894 11:116248772-116248794 TTTCCCCTCTAGATAAAGGCGGG - Intergenic
1090630570 11:128643844-128643866 TTTCCCCTGTGGTTGAGTGGTGG - Intergenic
1094149488 12:27267158-27267180 TATTCCCTTTAGATGAATGATGG - Intronic
1094262023 12:28511516-28511538 TTTCCCCTCAAGAAGAATGAGGG + Intronic
1094346758 12:29478586-29478608 TTTCCCTTCTAGAAGGGTTAAGG - Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1103043928 12:117719552-117719574 TTCCCCCTTTAGATGAGGCATGG + Intronic
1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG + Intergenic
1112669867 13:101622845-101622867 TTTCCCTTCCAGATCAGTGCTGG - Intronic
1113262022 13:108575438-108575460 TTTGCACTCTAGATGGCTGAAGG + Intergenic
1113595909 13:111532186-111532208 TTTCCCCTCTGTGTGCGTGAGGG - Intergenic
1116097982 14:40396426-40396448 TATTCCCTCTAGATAAATGAGGG + Intergenic
1116911031 14:50464619-50464641 TTTCCCCACTTCATCAGTGAAGG - Intronic
1118096868 14:62546778-62546800 TTTCCCCTCAAGCAGAGGGAAGG - Intergenic
1120210989 14:81633703-81633725 TTTGCCCTGTAGATAAGAGATGG + Intergenic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1120714076 14:87821816-87821838 TCTTCCCTCAGGATGAGTGAGGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1202932996 14_KI270725v1_random:56446-56468 TATTCCCTTTAGATGAATGATGG - Intergenic
1125581290 15:40787780-40787802 TTTCACCTCTTGATGGGGGAAGG + Intronic
1125714936 15:41814179-41814201 TTTCCCATCTACATGACTGCTGG - Intronic
1126602746 15:50445163-50445185 TTTACCCTTTAGATGAGGTAGGG + Intronic
1127865906 15:63032460-63032482 TCTCCCCTCCCGATGACTGATGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129453132 15:75661833-75661855 TTTCCCCTCTAGATGAGTGAAGG + Exonic
1131357724 15:91760131-91760153 TTTCTCCCCTAGAGCAGTGATGG + Intergenic
1133283630 16:4680661-4680683 TTTCCTTTCTAGAGGGGTGAGGG + Intronic
1133442148 16:5829838-5829860 TTTCCCTTCTGAATGACTGAGGG - Intergenic
1133799430 16:9073187-9073209 TTTCCCCTCTGGCTGATTCATGG - Intergenic
1138866223 16:60823773-60823795 TTTGCCCTCTAACTGATTGAAGG + Intergenic
1140629633 16:76835692-76835714 ATTCCCCTCCTGATGAGTGAGGG - Intergenic
1141143852 16:81515343-81515365 TTTTCCATCTAGAAGCGTGAGGG - Intronic
1143486151 17:7255692-7255714 TTTCCCCTGTATATGGGGGAAGG + Intronic
1143856484 17:9854646-9854668 TATCCCCTGTAGATGAAGGAGGG - Intronic
1147325337 17:39667220-39667242 CTTCCCCTCTGGATGAGTCCCGG - Intergenic
1147778048 17:42917716-42917738 TTTTCCCTCTGGATTAATGAAGG - Intergenic
1148017589 17:44533175-44533197 TTTCCCCTTTACATGAGGTATGG - Intergenic
1148701026 17:49587076-49587098 TGTCCCCTCTAGACTAGAGACGG + Intergenic
1148924190 17:51067796-51067818 TTTCCCCTTTAGAATAATGATGG + Intronic
1150142027 17:62738377-62738399 TTTACCCTCTTGATGTGAGAAGG + Intronic
1151349491 17:73523288-73523310 CTTCCCCTCTTGATGAGGGGAGG + Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1157303557 18:46498928-46498950 TCTCCCCTGTAGGTGACTGAGGG - Intronic
1157547747 18:48559043-48559065 TCTCCCGTCTTGTTGAGTGATGG + Intronic
1158910851 18:62060400-62060422 TTTCTCCTCTATAAGGGTGATGG + Intronic
1162677646 19:12312179-12312201 TTTCCACGTTAGATGAATGAGGG - Intergenic
1162777086 19:12986239-12986261 TTTCGTCTCCAGATGAGCGACGG + Intergenic
1164424052 19:28124505-28124527 TTCCCCTTCTACATGAGTGTGGG + Intergenic
928455524 2:31417128-31417150 TTTCACCTCTAGTTAAGAGAGGG - Intergenic
931680624 2:64745722-64745744 TTACCACTCTCCATGAGTGAAGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934324956 2:92004759-92004781 TATTCCCTTTAGATGAATGATGG - Intergenic
934463337 2:94235468-94235490 TATTCCCTTTAGATGAATGATGG - Intergenic
934479212 2:94619283-94619305 TATCCCCTTTAGATGAGAAAAGG - Intergenic
936849552 2:116879048-116879070 TTTCCCTTGTAGATTAATGAAGG - Intergenic
937498463 2:122450696-122450718 TTCCCCCTCTAGTTCAGTGATGG - Intergenic
942096775 2:172542049-172542071 TCTTCCCTCTAAATGAGTAAAGG + Intergenic
1169813382 20:9631219-9631241 TATCCCCTCTCCATGAGTGTAGG + Intronic
1169900734 20:10549490-10549512 TATCCCCTCTAGGTGAGCAATGG - Intronic
1171172426 20:23027321-23027343 CTTCTCCTCTAGATCAGAGAAGG - Intergenic
1172995427 20:39066798-39066820 TTTTCCTTTTGGATGAGTGATGG + Intergenic
1175055913 20:56198012-56198034 GTTTCCTTCTAGTTGAGTGAGGG + Intergenic
1176594384 21:8678519-8678541 TATTCCCTTTAGATGAATGATGG - Intergenic
1180019432 21:45112354-45112376 TATCTGCTATAGATGAGTGAAGG + Intronic
1180277237 22:10655653-10655675 TATTCCCTTTAGATGAATGATGG - Intergenic
1180584460 22:16874541-16874563 TATTCCCTTTAGATGAATGATGG - Intergenic
1180818061 22:18805376-18805398 TTTCCCCTCTAGAAAATAGAAGG - Intergenic
1181135245 22:20761042-20761064 TGGTCCCTCTAGATGAGTGCTGG + Intronic
1181204279 22:21239831-21239853 TTTCCCCTCTAGAAAATAGAAGG - Intergenic
1182098697 22:27642772-27642794 TTTCCCCTCTTGTGAAGTGAAGG + Intergenic
1182264052 22:29098708-29098730 TTTTCCCTTTTGATGAGAGATGG + Intronic
1183620158 22:38967417-38967439 TATCTCCTCTAGAGGAGTAATGG + Intronic
1203222643 22_KI270731v1_random:55584-55606 TTTCCCCTCTAGAAAATAGAAGG + Intergenic
1203268186 22_KI270734v1_random:31230-31252 TTTCCCCTCTAGAAAATAGAAGG - Intergenic
952597517 3:35036033-35036055 TTTCCACACTAGATAATTGAAGG - Intergenic
953042658 3:39268721-39268743 TGTCCTCTCTGGCTGAGTGATGG + Intronic
957492187 3:80942839-80942861 TTTTGGCTCTAGATGAGTCAGGG - Intergenic
962905512 3:139797953-139797975 TTTTCCAGCTTGATGAGTGAGGG + Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
967240923 3:187438922-187438944 TTTACCCTCTACATGGGAGAAGG + Intergenic
967774431 3:193371927-193371949 AATCCCCTCTAGCTGAGTGTGGG - Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969059391 4:4423161-4423183 TTTCCCATCTATAGGAGGGAGGG - Intronic
973921020 4:55685129-55685151 TCTCTCTTCTAGATTAGTGAAGG - Intergenic
976654785 4:87477313-87477335 TTTCCCCTCTAGATAATGGTGGG + Intronic
977290121 4:95156382-95156404 TTTCCCCACTGGGTGATTGAAGG + Exonic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
986171165 5:5315936-5315958 TTTCCCCTCTGGATGAGGAATGG - Intronic
987073593 5:14360081-14360103 TTCCCACTCTAGAAGAGAGAAGG - Intronic
987861505 5:23492896-23492918 CTTCCTCTCTAGATCAGCGACGG + Intergenic
991263861 5:64693838-64693860 CTAGCCCTGTAGATGAGTGAAGG - Intronic
991356938 5:65778479-65778501 TTTCTCCTCTAACTCAGTGAAGG - Intronic
992008569 5:72504250-72504272 TTTCCTCTTTAGCTGAGTCATGG + Intronic
993692422 5:91018582-91018604 TTTCCCCTTTAGCTGACTTAGGG - Intronic
994116266 5:96064273-96064295 CTTACCCTCTATAAGAGTGAAGG + Intergenic
994360245 5:98842044-98842066 TTTTCCCTCTTAATGAGTAAAGG - Intergenic
994665008 5:102695338-102695360 GTCATCCTCTAGATGAGTGATGG + Intergenic
996810270 5:127508947-127508969 TTTCCTCCCCTGATGAGTGAGGG - Intergenic
1000297129 5:159921687-159921709 TTTCCCCTCCAAATAAATGAAGG + Intronic
1003853707 6:10251193-10251215 TTTCCGCTCTAGATAAGGGTTGG - Intergenic
1005597045 6:27389331-27389353 CTTCCCCTCTAGCTGGGCGAGGG + Intronic
1005815741 6:29550969-29550991 TTTGTCTTCTAGATGTGTGAGGG + Intergenic
1008645051 6:53505191-53505213 TTTCCATTCAAGATGATTGATGG - Intronic
1009887725 6:69644238-69644260 TTTCTCCTCTGGATGAATCAAGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011148282 6:84242715-84242737 CTTCCACTCTCCATGAGTGAAGG - Intergenic
1011587824 6:88945724-88945746 TTTCTCTTGTAGTTGAGTGAGGG + Intronic
1011786110 6:90846985-90847007 TTTCCCCTCTAGATGGCTCCAGG + Intergenic
1017147586 6:151248618-151248640 TTTATCCTCCAGATGTGTGAAGG - Intronic
1023176702 7:37442479-37442501 TTTCCTCTGTGGATGAGTCATGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028504414 7:91555716-91555738 TTTCCCATGAAGAGGAGTGAAGG - Intergenic
1032372901 7:131377797-131377819 TGTCTCCTCTTGATGAGCGACGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1036986553 8:13538222-13538244 TTTCTCCTCTAGGTGAGCAAGGG + Intergenic
1038340957 8:26684521-26684543 TCTCCCCTCTGGAGGAGTGGTGG + Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1042370068 8:67981418-67981440 TTTACCCTCTAATTGAGTAAAGG + Intronic
1043815206 8:84792915-84792937 TTCCACCTCTTGATGGGTGAGGG + Intronic
1043826936 8:84940404-84940426 TTTCCCCTATCAATGAGTAATGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047358323 8:124144340-124144362 TTCCCCCTCTAGATCTGTGATGG + Intergenic
1047595834 8:126377060-126377082 ATTCTCCTCTAGAAAAGTGAGGG - Intergenic
1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG + Intronic
1052943879 9:34151740-34151762 CTTCCCTTCTTGATGAGAGAAGG - Intergenic
1053483586 9:38434815-38434837 TTTTCCCTTTAGCTTAGTGAGGG + Intergenic
1053693403 9:40612112-40612134 TATTCCCTTTAGATGAATGATGG - Intergenic
1053940390 9:43242504-43242526 TATTCCCTTTAGATGAATGATGG - Intergenic
1054271426 9:63027975-63027997 TATTCCCTTTAGATGAATGATGG + Intergenic
1054304646 9:63411340-63411362 TATTCCCTTTAGATGAATGATGG - Intergenic
1054403393 9:64735359-64735381 TATTCCCTTTAGATGAATGATGG - Intergenic
1054437015 9:65220847-65220869 TATTCCCTTTAGATGAATGATGG - Intergenic
1054493382 9:65801145-65801167 TATTCCCTTTAGATGAATGATGG + Intergenic
1057545367 9:96016167-96016189 TTTCCCCTTTAAATTGGTGATGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058757938 9:108100923-108100945 TTTCAACTCCAGACGAGTGAGGG - Intergenic
1059519043 9:114922635-114922657 TTGCCTCTCTAGATGAGGGCAGG + Intronic
1186792013 X:13008796-13008818 TTTTCCCTCCAGAAGAGTAATGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187103976 X:16221608-16221630 TTTCCCCTCTAGTAGAGACAAGG - Intergenic
1187649222 X:21381972-21381994 CTCCCCCACTAGATGAGTGCAGG + Intronic
1188082546 X:25861215-25861237 TTTACCCACTAGTTGATTGATGG + Intergenic
1189534987 X:41926191-41926213 TTTCCCTAATAGATGAGAGACGG - Intergenic
1193976599 X:88127730-88127752 TTTCCCAGCTAGATAAGTGGTGG - Intergenic