ID: 1129454837

View in Genome Browser
Species Human (GRCh38)
Location 15:75671050-75671072
Sequence ACCAAGATCATACAGTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129454837_1129454845 19 Left 1129454837 15:75671050-75671072 CCAGCTCACTGTATGATCTTGGT No data
Right 1129454845 15:75671092-75671114 TTTTAGTGTCCCCTAATTAAAGG No data
1129454837_1129454849 27 Left 1129454837 15:75671050-75671072 CCAGCTCACTGTATGATCTTGGT No data
Right 1129454849 15:75671100-75671122 TCCCCTAATTAAAGGGTGAGGGG No data
1129454837_1129454847 25 Left 1129454837 15:75671050-75671072 CCAGCTCACTGTATGATCTTGGT No data
Right 1129454847 15:75671098-75671120 TGTCCCCTAATTAAAGGGTGAGG No data
1129454837_1129454848 26 Left 1129454837 15:75671050-75671072 CCAGCTCACTGTATGATCTTGGT No data
Right 1129454848 15:75671099-75671121 GTCCCCTAATTAAAGGGTGAGGG No data
1129454837_1129454846 20 Left 1129454837 15:75671050-75671072 CCAGCTCACTGTATGATCTTGGT No data
Right 1129454846 15:75671093-75671115 TTTAGTGTCCCCTAATTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129454837 Original CRISPR ACCAAGATCATACAGTGAGC TGG (reversed) Intergenic
No off target data available for this crispr