ID: 1129454841

View in Genome Browser
Species Human (GRCh38)
Location 15:75671079-75671101
Sequence GACACTAAAATGGGAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129454841_1129454845 -10 Left 1129454841 15:75671079-75671101 CCTGCCTCTCCCATTTTAGTGTC No data
Right 1129454845 15:75671092-75671114 TTTTAGTGTCCCCTAATTAAAGG No data
1129454841_1129454847 -4 Left 1129454841 15:75671079-75671101 CCTGCCTCTCCCATTTTAGTGTC No data
Right 1129454847 15:75671098-75671120 TGTCCCCTAATTAAAGGGTGAGG No data
1129454841_1129454849 -2 Left 1129454841 15:75671079-75671101 CCTGCCTCTCCCATTTTAGTGTC No data
Right 1129454849 15:75671100-75671122 TCCCCTAATTAAAGGGTGAGGGG No data
1129454841_1129454846 -9 Left 1129454841 15:75671079-75671101 CCTGCCTCTCCCATTTTAGTGTC No data
Right 1129454846 15:75671093-75671115 TTTAGTGTCCCCTAATTAAAGGG No data
1129454841_1129454853 13 Left 1129454841 15:75671079-75671101 CCTGCCTCTCCCATTTTAGTGTC No data
Right 1129454853 15:75671115-75671137 GTGAGGGGAAGACTTCAGTCAGG No data
1129454841_1129454848 -3 Left 1129454841 15:75671079-75671101 CCTGCCTCTCCCATTTTAGTGTC No data
Right 1129454848 15:75671099-75671121 GTCCCCTAATTAAAGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129454841 Original CRISPR GACACTAAAATGGGAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr