ID: 1129454842

View in Genome Browser
Species Human (GRCh38)
Location 15:75671083-75671105
Sequence AGGGGACACTAAAATGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129454842_1129454847 -8 Left 1129454842 15:75671083-75671105 CCTCTCCCATTTTAGTGTCCCCT No data
Right 1129454847 15:75671098-75671120 TGTCCCCTAATTAAAGGGTGAGG No data
1129454842_1129454853 9 Left 1129454842 15:75671083-75671105 CCTCTCCCATTTTAGTGTCCCCT No data
Right 1129454853 15:75671115-75671137 GTGAGGGGAAGACTTCAGTCAGG No data
1129454842_1129454848 -7 Left 1129454842 15:75671083-75671105 CCTCTCCCATTTTAGTGTCCCCT No data
Right 1129454848 15:75671099-75671121 GTCCCCTAATTAAAGGGTGAGGG No data
1129454842_1129454849 -6 Left 1129454842 15:75671083-75671105 CCTCTCCCATTTTAGTGTCCCCT No data
Right 1129454849 15:75671100-75671122 TCCCCTAATTAAAGGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129454842 Original CRISPR AGGGGACACTAAAATGGGAG AGG (reversed) Intergenic
No off target data available for this crispr