ID: 1129454849

View in Genome Browser
Species Human (GRCh38)
Location 15:75671100-75671122
Sequence TCCCCTAATTAAAGGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129454840_1129454849 -1 Left 1129454840 15:75671078-75671100 CCCTGCCTCTCCCATTTTAGTGT No data
Right 1129454849 15:75671100-75671122 TCCCCTAATTAAAGGGTGAGGGG No data
1129454837_1129454849 27 Left 1129454837 15:75671050-75671072 CCAGCTCACTGTATGATCTTGGT No data
Right 1129454849 15:75671100-75671122 TCCCCTAATTAAAGGGTGAGGGG No data
1129454842_1129454849 -6 Left 1129454842 15:75671083-75671105 CCTCTCCCATTTTAGTGTCCCCT No data
Right 1129454849 15:75671100-75671122 TCCCCTAATTAAAGGGTGAGGGG No data
1129454835_1129454849 30 Left 1129454835 15:75671047-75671069 CCACCAGCTCACTGTATGATCTT No data
Right 1129454849 15:75671100-75671122 TCCCCTAATTAAAGGGTGAGGGG No data
1129454841_1129454849 -2 Left 1129454841 15:75671079-75671101 CCTGCCTCTCCCATTTTAGTGTC No data
Right 1129454849 15:75671100-75671122 TCCCCTAATTAAAGGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129454849 Original CRISPR TCCCCTAATTAAAGGGTGAG GGG Intergenic
No off target data available for this crispr