ID: 1129454917

View in Genome Browser
Species Human (GRCh38)
Location 15:75671581-75671603
Sequence GTGGCCACCAAGATAATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129454917_1129454921 -7 Left 1129454917 15:75671581-75671603 CCACCAATTATCTTGGTGGCCAC No data
Right 1129454921 15:75671597-75671619 TGGCCACAGAGGGCCCTCCAAGG No data
1129454917_1129454926 13 Left 1129454917 15:75671581-75671603 CCACCAATTATCTTGGTGGCCAC No data
Right 1129454926 15:75671617-75671639 AGGAGCTGATGCCCTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129454917 Original CRISPR GTGGCCACCAAGATAATTGG TGG (reversed) Intergenic
No off target data available for this crispr