ID: 1129456139

View in Genome Browser
Species Human (GRCh38)
Location 15:75677040-75677062
Sequence GGCCTTTGCCATCACGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 84}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129456139_1129456150 15 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456150 15:75677078-75677100 CCAGCCACGGAGGCCCCTGCTGG 0: 1
1: 0
2: 1
3: 36
4: 323
1129456139_1129456153 25 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456153 15:75677088-75677110 AGGCCCCTGCTGGCCCCTGGAGG 0: 1
1: 0
2: 8
3: 62
4: 503
1129456139_1129456144 -10 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456144 15:75677053-75677075 GGCAAAGGCCTCTGAGGTTTGGG 0: 1
1: 1
2: 1
3: 26
4: 263
1129456139_1129456145 -9 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456145 15:75677054-75677076 GCAAAGGCCTCTGAGGTTTGGGG 0: 2
1: 0
2: 4
3: 17
4: 215
1129456139_1129456152 22 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456152 15:75677085-75677107 CGGAGGCCCCTGCTGGCCCCTGG 0: 1
1: 0
2: 4
3: 112
4: 715
1129456139_1129456147 2 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456147 15:75677065-75677087 TGAGGTTTGGGGTCCAGCCACGG 0: 1
1: 0
2: 3
3: 24
4: 256
1129456139_1129456155 28 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456155 15:75677091-75677113 CCCCTGCTGGCCCCTGGAGGTGG 0: 1
1: 0
2: 7
3: 64
4: 461
1129456139_1129456148 5 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456148 15:75677068-75677090 GGTTTGGGGTCCAGCCACGGAGG 0: 1
1: 0
2: 2
3: 20
4: 244
1129456139_1129456157 29 Left 1129456139 15:75677040-75677062 CCCTCACCGTGATGGCAAAGGCC 0: 1
1: 0
2: 2
3: 2
4: 84
Right 1129456157 15:75677092-75677114 CCCTGCTGGCCCCTGGAGGTGGG 0: 1
1: 0
2: 4
3: 70
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129456139 Original CRISPR GGCCTTTGCCATCACGGTGA GGG (reversed) Exonic
904907449 1:33908461-33908483 GGCCTGTGCCAGGACTGTGAAGG - Intronic
907805423 1:57814403-57814425 GGCAGTTGCCATCATGGTGCTGG - Intronic
908122597 1:61000248-61000270 GGCCTGTGCCATAACCCTGATGG - Intronic
910402559 1:86852087-86852109 TGCCATTGCCAACATGGTGATGG - Intergenic
920103069 1:203529995-203530017 GGCCTTTGCTAACACAGGGATGG - Intergenic
1064313788 10:14236139-14236161 GTCTTTTGCCATCAAGTTGAAGG - Intronic
1075613470 10:123873055-123873077 GGTCTTTGCCAACACAGTAAAGG + Intronic
1076753451 10:132555251-132555273 GCCCTTCCCCAGCACGGTGAAGG - Intronic
1077219372 11:1408619-1408641 GACCTGTGCCATCAGGTTGAGGG - Intronic
1079814945 11:25044435-25044457 TGCCTTTGCCATCAGTGAGATGG - Intronic
1082248096 11:49948414-49948436 GTCCTTTGCCATCTTGATGATGG - Intergenic
1084218196 11:67662934-67662956 GCCCTTTGCCCTCTCGGTCAGGG - Exonic
1085044394 11:73344681-73344703 CGCCTTTGCCTTCACGGTGATGG + Intronic
1091403533 12:195385-195407 GGCATTTGCCATCTCACTGAGGG - Intronic
1097843200 12:64341725-64341747 GGCCTTTTCCATCATGGAAAGGG - Intronic
1103904260 12:124319431-124319453 CGCCCCTGCCATCATGGTGAGGG + Intergenic
1104483177 12:129126587-129126609 TGCCTGTGCCATCAGGGTGGGGG + Intronic
1105723865 13:23142089-23142111 GGCCTTGGCCAGCCCGGAGAGGG - Intergenic
1106177370 13:27342711-27342733 GGCCATTTCCATCACAGAGAGGG + Intergenic
1109884331 13:68523883-68523905 GGCCTTGGCCAGCCCAGTGAGGG - Intergenic
1112886065 13:104173524-104173546 GGCCTTTGATATGAAGGTGAAGG - Intergenic
1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG + Intronic
1116482437 14:45407446-45407468 GGCCTTTTACATGAAGGTGAAGG - Intergenic
1119558087 14:75568597-75568619 GGCCTTTGCCACCACGGTCATGG + Intergenic
1119720568 14:76887362-76887384 GCCCTTTCCCTTCACGGTGCCGG - Intergenic
1129456139 15:75677040-75677062 GGCCTTTGCCATCACGGTGAGGG - Exonic
1134361882 16:13539061-13539083 GGTCTTTGGCATCATGATGAGGG + Intergenic
1135522051 16:23185087-23185109 GGCGTATGCCATAGCGGTGAAGG + Intronic
1136160272 16:28415259-28415281 GGCCTTTGGCATGATGCTGATGG - Intergenic
1136202816 16:28700031-28700053 GGCCTTTGGCATGATGCTGATGG + Intronic
1137380594 16:47995495-47995517 GGCCTGTGCCATGACGGTAGGGG - Intergenic
1138204298 16:55113714-55113736 GGCCTTGGCCCTCACTGCGATGG - Intergenic
1138352124 16:56351722-56351744 GGCCATTTCCACCACGCTGAGGG - Intronic
1141211542 16:81985172-81985194 GGCCTGTGCTATCTCGATGATGG + Intergenic
1141506876 16:84483707-84483729 GGCCTCTGCCATCAGGGTCTGGG + Intronic
1142144140 16:88485787-88485809 GTCCTTTGACCTCAGGGTGAGGG + Intronic
1143548573 17:7614745-7614767 GGCCGTTTCCCTCACGGTGGCGG - Exonic
1146630622 17:34466839-34466861 GGCCTTTGTCAGCAGAGTGAGGG - Intergenic
1147338751 17:39741605-39741627 GGCCTTTGCCCTGACCCTGAGGG + Intronic
1161641934 19:5429474-5429496 TGCCTTAGCCTTCAAGGTGATGG - Intergenic
1162391227 19:10391307-10391329 GGCCTTTGGCATAATGCTGATGG + Exonic
1166391132 19:42409564-42409586 GGCCTCTGCCCTCCCGGGGACGG + Intronic
925040662 2:731248-731270 AGCCTATCCCATCACAGTGAGGG - Intergenic
925449175 2:3953607-3953629 GGCCTTTGGAGTCACAGTGATGG + Intergenic
929138070 2:38643480-38643502 GGCCTTGGCCATCCCAGAGAGGG + Intergenic
932002703 2:67899243-67899265 GGCCTTTGCCATCTTGCTGGGGG - Intergenic
938746039 2:134279164-134279186 AACCTTTGCCATGACGCTGATGG + Intronic
940112414 2:150169418-150169440 GGCCTTTGGCCTCAGAGTGAGGG - Intergenic
945459825 2:210093026-210093048 GGCCTATGCCATTACAGTAAAGG - Intronic
1169622578 20:7524670-7524692 AGCCTTTGCCAGCATGGGGATGG - Intergenic
1174167434 20:48595017-48595039 GGCCATCACCATCACTGTGAGGG + Intergenic
1178074578 21:29003037-29003059 GTCCTTTGCCATCCCTGCGAGGG - Intergenic
1180714746 22:17864316-17864338 GGCATGTCCCATCACGGTGCAGG + Intronic
1181455813 22:23059603-23059625 GGCCTCTGCCAGCATGGTAAGGG + Exonic
1181547094 22:23608244-23608266 GGCCTCTGGCAGCATGGTGAGGG - Intergenic
950707704 3:14793240-14793262 CACCTTTGCCCCCACGGTGAAGG + Intergenic
960085260 3:113583602-113583624 TGCCTTTCCCATCATGATGATGG - Intronic
963129810 3:141847699-141847721 GGTATGTGCCATCACGATGAAGG + Intergenic
964993553 3:162845018-162845040 GGCCTTGGCCAGCACAGAGAGGG + Intergenic
970745511 4:19290135-19290157 GTCCTTTGCCTACACTGTGATGG + Intergenic
971639766 4:29117294-29117316 GGCCTTGGCCATCCCGGAAAAGG - Intergenic
973295031 4:48509085-48509107 AGCCTTTTCCATCATGGTTATGG - Intronic
973944631 4:55944152-55944174 GGCCCTTGCCATCAATGTGAAGG - Intergenic
974506054 4:62773445-62773467 GGCCTTTCCCATCAAGTTAAAGG - Intergenic
976133239 4:81907420-81907442 GGCCTTTTACATCACTCTGAGGG - Intronic
985536213 5:467080-467102 GGCCTTTGACAGCACAGTGAGGG - Exonic
985609295 5:877984-878006 GGCATTTGCCATGAAGGTGTGGG - Intronic
988610021 5:32714345-32714367 GGCCTCAGCCACCACTGTGAGGG - Intronic
990332739 5:54743790-54743812 TGCCTTTGTCATCAGGGTAAAGG - Intergenic
997723610 5:136101568-136101590 GGACTTTGCCATAACTGTTAAGG - Intergenic
1000651779 5:163827052-163827074 GGCCTTGGCCATCTCAGTTATGG - Intergenic
1002349457 5:178573352-178573374 GGCCTTTGCCATGACTCTGCTGG - Intronic
1019622911 7:2001318-2001340 GGCCTTGGCCATGTCTGTGAAGG - Intronic
1021129043 7:16888602-16888624 GGCCATTTCCATCACAGTTATGG + Intergenic
1021970703 7:25963030-25963052 GGCCTTGGCCACCAAGGGGATGG + Intergenic
1024991995 7:55242115-55242137 GGCCATGCCCATCAGGGTGAGGG - Intronic
1026706539 7:72698740-72698762 GGATTTTGCCATCATGGTGCAGG - Intronic
1031425420 7:121599553-121599575 AGCATTTGCCATCAGGTTGAAGG + Intergenic
1032236599 7:130129812-130129834 CACCTTTGACATCACGGTCAGGG - Intronic
1033438089 7:141352320-141352342 TGCCTTGGCCACCAGGGTGAAGG - Intronic
1039984310 8:42435364-42435386 TGCTCTTGCCATCACGGTCATGG - Intronic
1045407444 8:101880426-101880448 GGCCTTGGCCAGCCCGGAGAGGG + Intronic
1049339908 8:142106541-142106563 GGCCTCTGCCAGCAAGGGGACGG - Intergenic
1050140297 9:2510518-2510540 GGCACTTGCCACCAAGGTGAAGG - Intergenic
1058468660 9:105254462-105254484 GGACTTTGCCAGCAAGGTGGCGG + Intronic
1060852706 9:126890398-126890420 GGCCTTTGCCAGCCCTGTGGGGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1188989044 X:36795085-36795107 GGCTTTGGCCAGCAGGGTGATGG + Intergenic
1193608878 X:83604164-83604186 TGCTTTTTCCATCACAGTGATGG - Intergenic