ID: 1129457795

View in Genome Browser
Species Human (GRCh38)
Location 15:75684945-75684967
Sequence CAGGGCATGAAGGGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129457795_1129457801 -6 Left 1129457795 15:75684945-75684967 CCAGCAGCACCCTTCATGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1129457801 15:75684962-75684984 GCCCTGCCTTTGGGTGCAGGAGG 0: 2
1: 0
2: 1
3: 28
4: 295
1129457795_1129457805 11 Left 1129457795 15:75684945-75684967 CCAGCAGCACCCTTCATGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1129457805 15:75684979-75685001 AGGAGGAGACTGACTCTTTTAGG 0: 2
1: 0
2: 4
3: 21
4: 185
1129457795_1129457807 28 Left 1129457795 15:75684945-75684967 CCAGCAGCACCCTTCATGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1129457807 15:75684996-75685018 TTTAGGGCTTCATTTTCCATTGG 0: 1
1: 0
2: 1
3: 19
4: 223
1129457795_1129457800 -9 Left 1129457795 15:75684945-75684967 CCAGCAGCACCCTTCATGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1129457800 15:75684959-75684981 CATGCCCTGCCTTTGGGTGCAGG 0: 2
1: 0
2: 7
3: 28
4: 240
1129457795_1129457806 12 Left 1129457795 15:75684945-75684967 CCAGCAGCACCCTTCATGCCCTG 0: 1
1: 0
2: 2
3: 40
4: 335
Right 1129457806 15:75684980-75685002 GGAGGAGACTGACTCTTTTAGGG 0: 2
1: 0
2: 6
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129457795 Original CRISPR CAGGGCATGAAGGGTGCTGC TGG (reversed) Intronic
900485243 1:2919693-2919715 CAGGGCAGGGAGTGTCCTGCCGG + Intergenic
900581473 1:3411896-3411918 CAGGGCACGACGGCAGCTGCGGG + Exonic
901027279 1:6285308-6285330 CAGGGCTTGGAAGGGGCTGCTGG - Intronic
901324616 1:8359112-8359134 CTGGGCCTGAGGGGAGCTGCGGG - Intronic
902408849 1:16201374-16201396 CAGGGTATGAGGGGTGGTGGGGG - Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
903332118 1:22601604-22601626 CTGTGAAGGAAGGGTGCTGCTGG - Intronic
903669774 1:25028501-25028523 GAGGGCATGGGGGGTGCTGCAGG + Intergenic
904454099 1:30636563-30636585 CAAGGTATGAGGGCTGCTGCAGG + Intergenic
905029265 1:34870572-34870594 CAGGCCCAGAAGGATGCTGCAGG + Intronic
905113593 1:35617323-35617345 CCGGGCATGATGGGTCATGCCGG - Intronic
906195860 1:43930488-43930510 CTGGGCAGCAAGGCTGCTGCCGG + Exonic
906381055 1:45332399-45332421 CTGGGAAACAAGGGTGCTGCTGG + Exonic
907687220 1:56623731-56623753 CAGCTCATGAAAGCTGCTGCAGG + Intronic
907890474 1:58631902-58631924 CAGAGCATTAAGGGTGATTCTGG + Intergenic
911130461 1:94382431-94382453 CATGGCATGAAGGGCGGGGCAGG - Intergenic
911277434 1:95879292-95879314 CAGGCCATGAAAGCAGCTGCAGG - Intergenic
912471497 1:109910280-109910302 CAGAGGAAGAAGGGGGCTGCCGG + Intronic
912512960 1:110200929-110200951 CAGGGCCGGCAGGGTGCTTCGGG + Exonic
912591377 1:110824375-110824397 CAGGGCAGTGGGGGTGCTGCAGG + Intergenic
912614971 1:111090126-111090148 CAGGGCAAGAGGTGAGCTGCTGG + Intergenic
915243003 1:154537196-154537218 CAGGGGATGAAGGGTGCCAGGGG - Intronic
915582536 1:156823530-156823552 AAGCACATGGAGGGTGCTGCTGG + Intronic
915730049 1:158046893-158046915 CAGAGCATGGAGGGGGTTGCTGG + Intronic
916790701 1:168122550-168122572 CAGGCCCTGGAGGGAGCTGCAGG - Intronic
917046652 1:170867993-170868015 CAGGGCAGGAACAGTGGTGCTGG + Intergenic
919945701 1:202317945-202317967 CAGGGCTTGAAGGGGCCTGTAGG - Exonic
922794430 1:228333127-228333149 CAGGGCGGGAGGGGTGCTGAGGG - Intronic
923475422 1:234326987-234327009 GAGGGCATGAAGTGACCTGCTGG + Intergenic
923630306 1:235645255-235645277 CAGGGCAGGGAGGCTGCTGAGGG - Intronic
923778605 1:237001623-237001645 CATGGCATGCAGGCTGCTGCTGG - Intergenic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
1063010000 10:2012377-2012399 CAGGGAATGGAGGGTGTTTCTGG + Intergenic
1063588310 10:7372880-7372902 TAGGGCAGGCAGGGGGCTGCAGG - Intronic
1064480881 10:15739546-15739568 CAGTGCATCAAGGTTGCTTCTGG + Intergenic
1064612149 10:17114740-17114762 CAGGGCATGGAGGGTCGTTCTGG + Intronic
1067897037 10:50193627-50193649 GAGGGGATGAGGGGTGCTGGGGG + Intronic
1067951936 10:50748413-50748435 GAGGGGATGAGGGGTGCTGGGGG - Intronic
1069400156 10:68035815-68035837 CAGGGAAGGAAGGCTCCTGCTGG - Intronic
1069599205 10:69692636-69692658 CTGGGCAGGAAGGGTGATGAGGG + Intergenic
1069599436 10:69693927-69693949 CTGGGCAGGAAGGGTGATGAGGG - Intergenic
1069917371 10:71795919-71795941 CAGGACAGGAAGGGTGGTGGGGG - Exonic
1070035511 10:72718994-72719016 GAGGGTATGAAGGGGGCTCCTGG + Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1071601067 10:86958961-86958983 CAGGGCATTGTGGGTGCTCCAGG - Intronic
1073289177 10:102404984-102405006 CAGGGCATGGTGGATGCTGATGG + Exonic
1073952951 10:108831857-108831879 CAGGACATGGATGGAGCTGCAGG + Intergenic
1077123892 11:924117-924139 CAGGGCAATGGGGGTGCTGCAGG - Intergenic
1077374665 11:2199916-2199938 CAGCTCAGGAAGGGGGCTGCTGG - Intergenic
1078104330 11:8349329-8349351 CAGGGCACAAAGGGTTCTCCAGG - Intergenic
1080431930 11:32207409-32207431 GAGGGGCTGAAGGGTGCTGTTGG - Intergenic
1081513079 11:43795894-43795916 AAGGGCATGAGGAGTGCTGGGGG + Intronic
1081568429 11:44275066-44275088 AGGGGCAGGAAGGCTGCTGCTGG - Intronic
1082665510 11:55971169-55971191 CAGTGCAGGGAGGGTGCTGGTGG - Intergenic
1083195315 11:61082411-61082433 CCCGGCAGGAAGGGGGCTGCAGG - Intergenic
1083198732 11:61106516-61106538 CAGGGAATGAAGGGACCTGGGGG + Intronic
1083308157 11:61771544-61771566 CTGGGCATTGAGGGTGCTGGGGG - Exonic
1083668248 11:64286610-64286632 CAGGGCATACAGGGTGGTGTAGG - Exonic
1084603611 11:70160532-70160554 GAGAGCTAGAAGGGTGCTGCTGG + Intronic
1086633367 11:89051381-89051403 CAGGCCATGCAGGATGTTGCAGG + Intronic
1086892188 11:92271064-92271086 CAGGGCTTGGAGGCTGCTGCAGG - Intergenic
1087500501 11:98945758-98945780 CAGGGCATTAATGATACTGCAGG - Intergenic
1087617456 11:100504776-100504798 AAGGGCATGAAGGTTGTTACAGG + Intergenic
1088560170 11:111106687-111106709 CAGAGCATGAATGCTGCAGCTGG - Intergenic
1089499402 11:118923671-118923693 CACAGCAGGAAGGGTGCTGAGGG - Intronic
1089846725 11:121464615-121464637 CAGGGCACGCAGGGGGCTGAGGG + Intronic
1090400841 11:126447356-126447378 CAGGTCATGAAGGCTGAGGCTGG - Intronic
1090442690 11:126737294-126737316 CAGGGCAGAGAGGGTGCTGGTGG + Intronic
1091197391 11:133743588-133743610 CAGAGCATTAAGGGTGATTCTGG + Intergenic
1091692437 12:2606196-2606218 GAGGACACGAGGGGTGCTGCAGG - Intronic
1091719105 12:2799666-2799688 AAGGGTATGAAGGATGCTGAGGG + Intronic
1095099092 12:38162868-38162890 CATGGCATGGAGCGTGCTGACGG + Intergenic
1096106322 12:48998599-48998621 CTGGGCCTCCAGGGTGCTGCAGG - Exonic
1098304640 12:69090330-69090352 CAAGGCAGGAAGGCTGCTGAGGG - Intergenic
1099139957 12:78960622-78960644 CATGTTATGAAGGGGGCTGCAGG + Intronic
1100064230 12:90621849-90621871 CAGGTTATGATGGATGCTGCTGG + Intergenic
1101652972 12:106694430-106694452 AGGGGCCTGAAGGATGCTGCAGG + Intronic
1102451067 12:113042528-113042550 AAGGGACTGGAGGGTGCTGCTGG + Intergenic
1102465851 12:113130557-113130579 CCGGGCCTGCCGGGTGCTGCGGG - Intronic
1102688523 12:114742480-114742502 CAGGGTCTGGAGGGTGATGCAGG + Intergenic
1104395427 12:128428281-128428303 CAGGGCATGAATGATGTTCCTGG + Intronic
1105260049 13:18772448-18772470 CAGCCCATGAAAGGAGCTGCAGG + Intergenic
1105572014 13:21611627-21611649 CATGGCAGGGAGGGTGCTGCTGG + Intergenic
1106102279 13:26705485-26705507 CAGGTCATGCAGGGGGATGCAGG + Intergenic
1107832955 13:44390583-44390605 CAGGGCACAAAGGAGGCTGCAGG - Intronic
1108225548 13:48285448-48285470 AAGGGCATGAAGGATCATGCAGG - Intergenic
1108490453 13:50976262-50976284 CAGGGCCTGAGAGGAGCTGCTGG - Intergenic
1111277790 13:85973851-85973873 CAGAGCATTAAGGGTGTTGTGGG - Intergenic
1113317618 13:109199681-109199703 CTGGGGATTAAGGATGCTGCTGG - Intronic
1113823541 13:113232430-113232452 CAGGGCAGGAGTGGTGCTGGTGG - Intronic
1113938589 13:114007267-114007289 CAGGGCAGGAGGGGGGCGGCAGG - Intronic
1114447150 14:22797638-22797660 GAGTGCATGGAGGCTGCTGCTGG + Intronic
1117344616 14:54820033-54820055 CAGGTCATGAAGGGTCTTGTGGG - Intergenic
1119143654 14:72290804-72290826 CCAGCCATGAAGGGTGTTGCTGG - Intronic
1119319487 14:73721247-73721269 CAGGGCAAGCAGGGTGGAGCTGG - Intronic
1119473905 14:74916122-74916144 CTGGGCCTGAGGGTTGCTGCTGG + Intronic
1121717134 14:96084310-96084332 TTGGGCATGACGGGGGCTGCAGG - Intronic
1122089762 14:99330526-99330548 CTTGGCATGCTGGGTGCTGCAGG + Intergenic
1122119403 14:99543916-99543938 ATGGGCATGCAGGGTGTTGCAGG + Intronic
1122797384 14:104212804-104212826 CAGGGCAGCAAGGTGGCTGCAGG + Intergenic
1124337562 15:28868711-28868733 CAGGGAGTGGAGGGTGATGCTGG - Intergenic
1124341735 15:28894347-28894369 GAGGGCATGGAGGGGGCTGCTGG + Intronic
1124439871 15:29678045-29678067 CAGGGAGTGAGGGGAGCTGCAGG - Intergenic
1124445028 15:29722752-29722774 CAGTCCATGAAAGGAGCTGCAGG + Intronic
1126177066 15:45745707-45745729 CAGGGAAGGTAGGTTGCTGCTGG + Intergenic
1126670875 15:51113947-51113969 CAGGGCATGTAGAGTGTTACAGG - Intergenic
1128220005 15:65962396-65962418 CAGTGGAAGAAGGGTGCTACTGG + Intronic
1128230635 15:66032444-66032466 CAGAGCATTAAGGGTGATCCTGG + Intronic
1128599920 15:68987628-68987650 CAGAGGATGCAGGGCGCTGCTGG - Intronic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1129565166 15:76614095-76614117 AGGGACATGAATGGTGCTGCGGG + Intronic
1129880001 15:79000036-79000058 CAGGGCATGTCGGGTGGTGCTGG + Intronic
1129993387 15:79984087-79984109 CAGGGAATGAAGGGAACTGGTGG - Intergenic
1130274064 15:82467430-82467452 CAGAACATGAAGGGTACTGCTGG + Intergenic
1130466412 15:84194804-84194826 CAGAACATGAAGGGTGCTGCTGG + Intergenic
1130497852 15:84478732-84478754 CAGAACATGAAGGGTGCTGCTGG - Intergenic
1130588706 15:85199397-85199419 CAGAACATGAAGGGTACTGCTGG + Intergenic
1130926028 15:88386533-88386555 CCTGGCACAAAGGGTGCTGCTGG - Intergenic
1131016127 15:89059130-89059152 GAGGGCATGATGGGAGATGCTGG - Intergenic
1131172725 15:90190132-90190154 CAGTGCATAAATGGTGCTGCAGG + Intronic
1132484061 16:181171-181193 CACGGCAAGAAGGCTGCTCCTGG - Exonic
1132649519 16:1014220-1014242 CAGGGCAGGAGGGGGGCTGCAGG - Intergenic
1132971743 16:2692668-2692690 GAGGGCATGAAGGCTGGGGCCGG - Intronic
1133076729 16:3285780-3285802 CAGGGGAGGAAGGGTGCTGGGGG - Intronic
1133933308 16:10249718-10249740 CAGGACATGCAGGGGGCAGCTGG - Intergenic
1134007538 16:10828160-10828182 CAGAGCATGATGAGTGGTGCAGG - Intergenic
1135404640 16:22189659-22189681 GAGGGCATGAAGGCTGCGACTGG + Intronic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1136399518 16:30010082-30010104 CAGGACCTGAAGGGGGCGGCGGG - Exonic
1137242913 16:46673520-46673542 CAGGGCAGGAAGGGAACTGCTGG + Intronic
1138246561 16:55470994-55471016 CAGGGTGTGGAGGGTTCTGCAGG + Intronic
1138454935 16:57115764-57115786 CAGTGCAGGGAGGGGGCTGCTGG - Intronic
1140032263 16:71348298-71348320 TGGGGCATGAAGGGTACTGCAGG + Intergenic
1140923145 16:79557940-79557962 CAAGGCCTGATGGGTGCTTCAGG + Intergenic
1141376432 16:83535151-83535173 CAGAGCATAAGGGGTGCTCCAGG + Intronic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1142178867 16:88657615-88657637 CAGGGCGGGCAGGGTGCTGACGG - Intronic
1142217101 16:88835096-88835118 CAGAGCATGAAGGGTCCCTCTGG - Intronic
1142594763 17:1024112-1024134 CTGGGCATGGAGCTTGCTGCCGG + Intronic
1145865744 17:28240520-28240542 CAGGGCAGGAAGGTTCCTGGAGG - Intergenic
1147304597 17:39554523-39554545 CAAGGCATGAATGGTTCTCCTGG - Intronic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1149530117 17:57388483-57388505 CTGGGCAAGAAGGGACCTGCTGG + Intronic
1151860463 17:76757334-76757356 TATGGCACGTAGGGTGCTGCAGG + Intronic
1152376621 17:79921936-79921958 CCGGGCAGGGTGGGTGCTGCGGG - Intergenic
1152404266 17:80087485-80087507 GAGGGGATGAAGGGAGCTACAGG + Intronic
1152723011 17:81932022-81932044 CAGGGTATGCAGGGGGCTCCAGG - Intergenic
1156701837 18:39835201-39835223 CAGGACATAAAGGTTGCTGGTGG + Intergenic
1157522607 18:48355783-48355805 CAGTGCCTGAAGTGAGCTGCAGG - Intronic
1159970749 18:74648962-74648984 CAGGGGATCAAGGGTGCGGAGGG - Intronic
1160702930 19:517337-517359 CAGGGCTGGATGGGAGCTGCGGG + Intronic
1160744614 19:704764-704786 CAGGGTTTGAAGGGTGGTGGAGG - Intergenic
1161504839 19:4638486-4638508 CAGGGCGGAAATGGTGCTGCAGG + Intergenic
1162808089 19:13149479-13149501 CAGGTCAGGAAAGGTCCTGCAGG - Exonic
1163005293 19:14393649-14393671 CAGGGCAGGAGGGGTGGGGCTGG - Intronic
1163051765 19:14689862-14689884 CAGAGCATGGAGGGTGGTGCTGG - Intronic
1163095719 19:15055567-15055589 CAGGCCAAGAAGGGTGCAGGCGG + Intronic
1164504555 19:28848670-28848692 CAGGGCATACAGGGTTATGCCGG - Intergenic
1164672156 19:30078286-30078308 CTGTGCGTGAAGGGAGCTGCCGG + Intergenic
1165139436 19:33689970-33689992 CAGAGCAGGAAGGGTGATTCTGG + Intronic
1165735032 19:38170392-38170414 CAGCACATGAGGGGGGCTGCTGG - Intronic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1166079440 19:40434373-40434395 CAGGGCAGGCAGAGAGCTGCAGG + Intergenic
1167619777 19:50554333-50554355 CAGGGCATGGAGGGTGACCCGGG - Intronic
1168127237 19:54291874-54291896 CTGGGCATGAAGGGATTTGCAGG + Intergenic
1168405384 19:56107815-56107837 CCGGGCATGCTGGGGGCTGCGGG + Intronic
1168405405 19:56107893-56107915 CCGGGCATGCTGGGGGCTGCGGG + Intronic
1168493675 19:56832724-56832746 CCAGGCAGGAAGGGTGCTTCTGG + Intronic
925178075 2:1798745-1798767 AGGGGCATGAAGGCTGCTGCAGG + Intronic
925843925 2:8018937-8018959 CAGGACATAAAGGGGGCTGAGGG + Intergenic
925869839 2:8260466-8260488 CAGGGAAGGGAAGGTGCTGCTGG - Intergenic
925913538 2:8588372-8588394 TAGTGCATGCTGGGTGCTGCTGG + Intergenic
926634787 2:15167408-15167430 CAGGGCATGAATGATGATGAAGG - Intronic
927433386 2:23046213-23046235 CAGGGCCTGTAGGGTGGTGGGGG + Intergenic
928112479 2:28521933-28521955 CAGGGAGTGCAGGCTGCTGCAGG - Intronic
928393287 2:30925605-30925627 GCGGGCAGGAAGAGTGCTGCAGG + Intronic
932416514 2:71576669-71576691 CAGGGCAGGAAGGCTGGAGCGGG + Intronic
934061328 2:88296920-88296942 GAGGACATGGAGGCTGCTGCTGG - Intergenic
934983556 2:98868244-98868266 CAGGGCTTGGAGGGTGCTCTGGG - Intronic
935643122 2:105309289-105309311 CAGAGAATGACGGGAGCTGCAGG + Intronic
938068108 2:128292691-128292713 CAGGGCATTCAGTGTGCAGCAGG + Intronic
940682377 2:156803372-156803394 CAGGGCAGGAAGGTTCCTGTCGG - Intergenic
941850826 2:170178207-170178229 CTGGGCCTGAAGTGTTCTGCTGG + Exonic
941891864 2:170590842-170590864 CAGGCCCTCTAGGGTGCTGCAGG + Intronic
941894373 2:170614467-170614489 CAGCTCATGATGGGTGCAGCTGG - Intronic
942074137 2:172341344-172341366 CATGGCACGAAAGCTGCTGCTGG - Intergenic
943691212 2:190871467-190871489 CAGAGCATTAAGGGTGATTCTGG - Intergenic
944127936 2:196315422-196315444 CAGTGGTTGAAGGGTGCTACTGG - Intronic
944628795 2:201600424-201600446 CAGGGCCTGTAGGGGGCTGGAGG + Intronic
945532777 2:210976791-210976813 CAGGTTCTGTAGGGTGCTGCAGG + Intergenic
945546334 2:211157151-211157173 TTGGGCATGAAAGGTGGTGCTGG - Intergenic
945773466 2:214075446-214075468 AAGGGCATGAAGGAGGCTTCTGG + Intronic
946788611 2:223275256-223275278 CAGTGCATGAGGTGAGCTGCTGG - Intergenic
946960766 2:224983541-224983563 CTCGGCGTGAAGGGTGCTGCAGG + Intronic
947712525 2:232324181-232324203 GAGGCCATGAAGGCAGCTGCTGG - Intronic
947719919 2:232363996-232364018 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
947731490 2:232433861-232433883 GAGGCCATGAAGGCAGCTGCTGG - Intergenic
948176911 2:235950571-235950593 CAGGGGATGAAGGCTGCTGTAGG + Intronic
948202189 2:236137228-236137250 CCGGGCAAGAAGGCTGCTGCTGG - Intergenic
948480640 2:238248061-238248083 CAGGGCTTGCAGGGTGCAGGTGG + Intronic
948525890 2:238570564-238570586 CAAGGGATGCAGGGGGCTGCGGG + Intergenic
948924676 2:241087681-241087703 CCGGGCATGCTGGGTGCTGGGGG + Exonic
1169340485 20:4792760-4792782 CAGGTGATGAAGGGTGCAGATGG + Intronic
1170129527 20:13003682-13003704 CAGGGCCTGAAGAGGGCTTCTGG + Intergenic
1170431237 20:16278794-16278816 CAGGGGATGGCGGGTGCTGTGGG - Intronic
1170880266 20:20290823-20290845 GAAGGCATGAAGGAGGCTGCAGG - Intronic
1172446687 20:34996990-34997012 CAGGGCCTGAAGGGGACTGGGGG + Intronic
1172965931 20:38835313-38835335 CAGGACATGATGGGGGCTGCAGG - Intronic
1173328828 20:42057375-42057397 CAGGGTTTGAAGGGTACAGCAGG + Intergenic
1174623443 20:51894824-51894846 CAGGGCAGGAAGGGAGTGGCAGG - Intergenic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175789249 20:61731328-61731350 GCGGTCAGGAAGGGTGCTGCGGG - Intronic
1176092691 20:63326002-63326024 CAGGGTGTGTTGGGTGCTGCTGG + Intronic
1176254079 20:64141484-64141506 GAGGGCAGGGAAGGTGCTGCAGG + Intergenic
1176254107 20:64141548-64141570 GAGGGCAGGGAAGGTGCTGCAGG + Intergenic
1179125626 21:38588323-38588345 CAGGGCTTGGAGGGTGGTGGTGG - Intronic
1179908765 21:44437261-44437283 CAGGGGCTGCAGGGGGCTGCAGG - Intronic
1181111513 22:20605534-20605556 CAGGGCAGGCAGGGTCCAGCCGG + Intergenic
1181419922 22:22790576-22790598 CAGGGCATGGAGGGTGGAGGTGG - Intronic
1181803571 22:25362067-25362089 CAGGGCATGAGGGATGCTCTGGG - Exonic
1183521510 22:38298488-38298510 CAGGGCATGGGTGGTGCTGGCGG - Intronic
1183699749 22:39444596-39444618 CCGGGCCTGAAGGGTGCTGAGGG + Intergenic
1184034817 22:41913358-41913380 CAGGGCATGGGGGTTGCTGGGGG + Intronic
1184048475 22:41987372-41987394 CAGAGCATGGAGGGTGCAGATGG - Intronic
1184694373 22:46131431-46131453 AAGGGCAGGAAGGGTGTTTCGGG + Intergenic
1185203506 22:49523128-49523150 CAGGGTGAGAAGGGTCCTGCTGG + Intronic
1185337043 22:50275348-50275370 TAGGGCATGGAGGCGGCTGCTGG + Exonic
1185340077 22:50287232-50287254 CAGGGCAGGGAGGGGGCTGACGG + Exonic
949822016 3:8125875-8125897 CAGAGCATTAAGGGTGATTCTGG - Intergenic
949848851 3:8400704-8400726 AGGGGCCTGAAGGGTGCTTCTGG - Intergenic
950460760 3:13121008-13121030 AAGGGGTTGCAGGGTGCTGCTGG - Intergenic
950510089 3:13420558-13420580 CAGGGCGGGATGCGTGCTGCGGG - Intergenic
952826909 3:37531801-37531823 CAGCCCTTGCAGGGTGCTGCAGG + Intronic
954136795 3:48585600-48585622 CAGGGCAGGACCGGTGCTCCCGG - Exonic
954360575 3:50120614-50120636 CACGGCATCAAGGGTGATGCTGG + Intergenic
955243863 3:57205463-57205485 CAGGTCATGTAGGGTCCTGCAGG - Intronic
955351633 3:58197794-58197816 GAGGCCCTGCAGGGTGCTGCTGG - Intronic
959813921 3:110652905-110652927 CGGGGCTTGAGGGTTGCTGCAGG + Intergenic
962265504 3:133941706-133941728 CAGGTCAGGAAGGGAGCCGCTGG - Intronic
963591830 3:147270091-147270113 CAGGCCAAGAAGAGTACTGCCGG - Intergenic
964288775 3:155152208-155152230 CAGGGCATAAAGGGTGGTCCAGG - Intronic
967355738 3:188568880-188568902 CAGGGCCTGAAGGGTGGAGAGGG + Intronic
967870308 3:194224070-194224092 CAGGGGTTGAAGGGTGCTGGTGG - Intergenic
968583154 4:1404115-1404137 CGGGGCTGGACGGGTGCTGCGGG + Intronic
968958332 4:3730382-3730404 CAGGGCATTTAGGGTGCCGGTGG + Intergenic
969254151 4:5991146-5991168 GAGGGCATGGAGGGTGCTGTGGG - Intergenic
969411777 4:7033335-7033357 CACGCCAGGAAGGGTGCTGCAGG - Intergenic
969501784 4:7557881-7557903 CAGAGCATGAAATGTGCTGGTGG - Intronic
969612726 4:8236226-8236248 CTGGGCAAGGTGGGTGCTGCGGG + Intronic
969697823 4:8745141-8745163 CAAGGCGTGCAGGCTGCTGCTGG + Intergenic
970036225 4:11738634-11738656 CAGACCATGAAGGCAGCTGCAGG + Intergenic
973123049 4:46546557-46546579 CAGGGAATGAATGGAGCTGGAGG - Intergenic
973205974 4:47560531-47560553 AAAGGTATGAAAGGTGCTGCTGG + Intronic
974584630 4:63856126-63856148 AAGGACATGAAGGGAGCTGGAGG + Intergenic
975441554 4:74417115-74417137 CAGGGGAAGAAGTGTGCTTCAGG + Intergenic
975620468 4:76291311-76291333 CTGGGCATGGATGCTGCTGCTGG - Intronic
978840623 4:113207933-113207955 CAGGGGATGAAGTGTGCTATGGG + Intronic
982055708 4:151546965-151546987 CAGGGGGTGGCGGGTGCTGCTGG - Intronic
983959455 4:173734629-173734651 CATGGCATGCACAGTGCTGCTGG + Intergenic
984947797 4:184983414-184983436 CAGAGTGTGAAGGGTGCAGCAGG - Intergenic
985341520 4:188959682-188959704 TAGAGCATGGAGGGTGTTGCAGG - Intergenic
985536615 5:468574-468596 CAGGGCTTGCTGGGTGCAGCTGG - Intronic
985635545 5:1034052-1034074 CTGGGCAAGAAGGGGTCTGCTGG + Intronic
986056862 5:4146738-4146760 CAGGTCATGAAGAGTGAGGCTGG - Intergenic
986290262 5:6394066-6394088 CAAGGCATAAAAGGGGCTGCAGG + Intergenic
986773635 5:10994836-10994858 CCAGGCTTGAAGGGTGCTGGTGG + Intronic
988563088 5:32298339-32298361 TAGGGAAAGAAGGGTGCTGTTGG + Intronic
989425898 5:41295238-41295260 AAGGGCAAGAAGAGTGATGCAGG + Intergenic
989543598 5:42646609-42646631 AAGGGAATGAATGGTTCTGCAGG + Intronic
990356280 5:54969371-54969393 CAGGGCAGCATGGGTGGTGCAGG - Intergenic
990370671 5:55114956-55114978 TAGGGCATGAAGGGTGTGGTAGG - Intronic
991503819 5:67303873-67303895 CAGGGCTTATAGGGTCCTGCAGG + Intergenic
994592705 5:101791935-101791957 AAGGGCATGGAGGGTGCCCCAGG + Intergenic
995119045 5:108516536-108516558 TGGGGTCTGAAGGGTGCTGCTGG - Intergenic
997352868 5:133243603-133243625 CAGGGCATGTAGGTGGCTGTAGG + Intronic
997411764 5:133696246-133696268 CAGGGCATGCAGGGGACTGGGGG + Intergenic
998206385 5:140159649-140159671 CATGGCCTGAATGGTGCTGCTGG + Intergenic
999443807 5:151622816-151622838 CAGGACATCAAAGGTGCTGCAGG + Intergenic
999778721 5:154831652-154831674 TGGAGCATGAAGGGTGCTGGTGG - Intronic
999905797 5:156140303-156140325 CTGAGCATTAAGGGTGCTTCTGG + Intronic
1001045556 5:168368833-168368855 CAGGGCATGGAGGGTGGTGGCGG + Intronic
1001583483 5:172816704-172816726 CATGGCACGAAGGGAACTGCAGG + Intergenic
1002170217 5:177370699-177370721 CAGGGCCTGAAGGGAGCGTCAGG - Intronic
1003880104 6:10472353-10472375 CAGAGCATGAAAGAGGCTGCAGG + Intergenic
1003977002 6:11353916-11353938 CAGGGCAGGAAGAGTGATGGGGG + Intronic
1005861770 6:29907707-29907729 CCAGGCATGGAGGGTGCTGTGGG + Intergenic
1006175003 6:32116376-32116398 CAGGGCATCCAGAGAGCTGCTGG - Intronic
1007097208 6:39220726-39220748 CACTGCATGATGGGTCCTGCAGG + Intronic
1007102678 6:39260935-39260957 CAGGGAATGGAGGGGGCTTCAGG - Intergenic
1007385937 6:41520151-41520173 CAGGGGCTGAAAGGAGCTGCAGG + Intergenic
1008274324 6:49525868-49525890 CAAGGTATGGAGGGAGCTGCAGG + Intronic
1010370549 6:75102024-75102046 CAAGGGATGAAAGGTGATGCTGG - Exonic
1010465476 6:76163018-76163040 CAGAGAATGTAGGGGGCTGCTGG + Intergenic
1012229812 6:96747616-96747638 CAGGACATGATGGCTCCTGCAGG - Intergenic
1012798166 6:103790223-103790245 CAGGGAATGAAGGCTGCCTCTGG + Intergenic
1013013404 6:106140292-106140314 TCGGGCATGAATGGTGCTGTTGG + Intergenic
1014904065 6:127004879-127004901 CAGGACCTGAAGGGGCCTGCAGG + Intergenic
1015282194 6:131445725-131445747 CAGGGCCTGTAGGGTGGTGGGGG + Intergenic
1015853451 6:137598833-137598855 CAGGGCATGCAGAATGCTGATGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016781654 6:147965775-147965797 CAGGGCCTGTAGGGGGCTGGGGG + Intergenic
1018804595 6:167248964-167248986 CAGGGCAGGCAGGGTGGTGCAGG + Intergenic
1019595321 7:1855720-1855742 CAGGCCATGAAAGGTGATGCTGG - Intronic
1019795247 7:3043806-3043828 CAGGGCCGGGAGGGGGCTGCGGG + Exonic
1020143272 7:5623993-5624015 CAGGCCATGCAGGCTTCTGCTGG - Intronic
1023058584 7:36309242-36309264 CAGGGGAGGAAGGGGCCTGCAGG - Intergenic
1023604896 7:41920925-41920947 CTGGTCATGATGGGTGCTACGGG + Intergenic
1023940389 7:44765533-44765555 CAGGGACTGAGGGGGGCTGCAGG - Exonic
1024313799 7:47994729-47994751 GAGGGCATGAGTGGTGGTGCTGG + Intronic
1025988145 7:66474036-66474058 CGTGGCATGAAGGGTGCCCCAGG - Intergenic
1026361328 7:69603132-69603154 CATGTCATTAAGGCTGCTGCTGG + Intronic
1026854214 7:73742595-73742617 CAGGCCAGGAAGCGTGCTGTTGG + Intergenic
1029157173 7:98525588-98525610 CAGGGCTTCAGGGCTGCTGCTGG + Intergenic
1029488950 7:100860001-100860023 CAGGGCATGGAGGATGCGGGAGG - Exonic
1032560669 7:132889610-132889632 CAGGGAAAGATGTGTGCTGCTGG - Intronic
1033612953 7:142983881-142983903 CATGGCATGCAGTGTGCTGGTGG + Intergenic
1034923095 7:155099672-155099694 GAGGGCATGGAGGCTCCTGCTGG - Intergenic
1035488925 7:159255064-159255086 CAGGGCCCGAAGAATGCTGCAGG + Intergenic
1036044670 8:5126572-5126594 CAGGGCTTGAAGCCTTCTGCAGG - Intergenic
1036082060 8:5567966-5567988 CAGTGGCTGAGGGGTGCTGCTGG + Intergenic
1036658033 8:10690424-10690446 CGGGGGATGAAGGATGCTGTTGG + Intronic
1036926933 8:12916077-12916099 CAGGTCATGAAGGGTCATGTGGG - Intergenic
1037651817 8:20845905-20845927 CAGGTCCTGTAGGGTTCTGCAGG + Intergenic
1038216506 8:25566616-25566638 CAAAGCATGAAGGTTGCTGGTGG - Intergenic
1038914941 8:32010683-32010705 CAGGTAATGAAGGGTAATGCTGG - Intronic
1039288724 8:36070781-36070803 CAGGGCATGTAGTTTGCTTCTGG + Intergenic
1039762332 8:40591134-40591156 CAGGGCAAGGAAGGTGCTGGTGG + Intronic
1039768770 8:40661375-40661397 CTGGGCATGATGGCTGATGCCGG - Intronic
1040905630 8:52467318-52467340 CAGAGCAGGGAGGGAGCTGCAGG - Intergenic
1041640989 8:60201445-60201467 CAGAGGATGAAAGGTGGTGCAGG + Intronic
1042716657 8:71780636-71780658 CAGGGGATGAAATGTGCTGATGG - Intergenic
1043163924 8:76879774-76879796 CAGGCCAAGAAGGGAGATGCTGG - Intergenic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1045025839 8:98085724-98085746 CAGGTCATGGAGGGCCCTGCAGG - Intronic
1045546740 8:103136251-103136273 CAGGGCATGAATGGTACACCTGG - Intronic
1046056207 8:109082089-109082111 CAGTCCATGAAGGCAGCTGCGGG - Intergenic
1048349981 8:133608309-133608331 CTGGGTATGAATGGTCCTGCAGG - Intergenic
1049165377 8:141122300-141122322 CAGGCCATGAGGGGAGCAGCAGG - Intronic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049359050 8:142203244-142203266 CAGTGCATGGCAGGTGCTGCTGG + Intergenic
1049487041 8:142871154-142871176 CAGGCCCTGAAGGATGCTGCTGG + Intronic
1049604042 8:143520907-143520929 CCAGCCATGGAGGGTGCTGCTGG - Intronic
1049748845 8:144274195-144274217 CAGGGCAGGGAGGGCGCCGCTGG - Intronic
1051564829 9:18485759-18485781 CAGATCATGCAGGGTGTTGCAGG + Intronic
1052251209 9:26399381-26399403 ATGGGCATGAAGGATACTGCAGG + Intergenic
1053414471 9:37938377-37938399 GAAGGCATAGAGGGTGCTGCAGG - Intronic
1056116733 9:83448146-83448168 AAAGGCATGAAGGATGCAGCAGG - Intronic
1056958967 9:91105111-91105133 CAGGCCGGGAAGGGTGCTGGAGG - Intergenic
1057694990 9:97316912-97316934 CAGGGCCTGAAGGGGACTGAGGG - Intronic
1057976374 9:99609922-99609944 GAGGGCATGTAGGCTGCTGGAGG - Intergenic
1058040389 9:100295747-100295769 CTGAGCAGGAAAGGTGCTGCTGG + Intronic
1058718155 9:107740344-107740366 CTAGGCATGTAGGGTGCCGCTGG - Intergenic
1059542584 9:115144714-115144736 ATAGGCATGAAGGGTGCTGCAGG + Intronic
1060679242 9:125546724-125546746 CAGGAAAGGAAGGGTGCTCCTGG + Intronic
1060782818 9:126425688-126425710 CAGGACATAAAGGATGGTGCTGG - Intronic
1060973134 9:127750100-127750122 CAAGGCAGGAAGGGTGTTCCAGG - Intronic
1061434025 9:130549324-130549346 CAGAGCATGAAGGATGGTGCAGG - Intergenic
1061789085 9:133049119-133049141 CAGGGGTCGAAGGGTGCTGATGG - Intronic
1062205756 9:135335981-135336003 ATGGGGATGAAGGGTGCTGTGGG - Intergenic
1062291551 9:135797497-135797519 CTGAACATGAAGGGTGCTGCTGG + Intergenic
1062363540 9:136198478-136198500 CAGGGCGGGGAGGGTGCTGGGGG + Intronic
1186386032 X:9110923-9110945 AAGGGCAGGAGGGGTACTGCTGG + Intronic
1187302487 X:18064588-18064610 CAGGGCATGAAGAGTGGAGGAGG - Intergenic
1188090618 X:25960187-25960209 CAGGGCATGGATGGAGCTGGAGG - Intergenic
1190108435 X:47574495-47574517 CAAGGCCTGAAAGGTGCTGCTGG + Exonic
1190228430 X:48563109-48563131 CAGGGCAGCAAGGGCCCTGCAGG + Intergenic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1192968518 X:76206123-76206145 CAGATCATGAAGAGTACTGCTGG + Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1195535977 X:106009622-106009644 CTGGGCATGATGGCTGATGCCGG - Intergenic
1198802002 X:140457672-140457694 CAGGTCATGCAGGGCCCTGCAGG - Intergenic
1199429832 X:147746265-147746287 CAGGTCATGGAGGGCCCTGCTGG - Intergenic
1199711520 X:150473084-150473106 CAGGGCCTGATGGATGCTGAAGG - Intronic
1200085011 X:153599578-153599600 CAGGGCTTGGCGGGCGCTGCCGG - Intronic
1200460802 Y:3452290-3452312 CAGAGCATTAAGGGTGATTCTGG + Intergenic
1201736356 Y:17266625-17266647 CAGGGTATGAAGAGTGGTGTGGG - Intergenic