ID: 1129457910

View in Genome Browser
Species Human (GRCh38)
Location 15:75685443-75685465
Sequence TCCCCTCGAGGGCGTCCTTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129457910_1129457921 23 Left 1129457910 15:75685443-75685465 CCACAAGGACGCCCTCGAGGGGA 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1129457921 15:75685489-75685511 CAGCGAGAAGGCATCGCTCCAGG 0: 2
1: 4
2: 0
3: 4
4: 103
1129457910_1129457922 30 Left 1129457910 15:75685443-75685465 CCACAAGGACGCCCTCGAGGGGA 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1129457922 15:75685496-75685518 AAGGCATCGCTCCAGGCCTCAGG 0: 2
1: 0
2: 5
3: 12
4: 175
1129457910_1129457918 11 Left 1129457910 15:75685443-75685465 CCACAAGGACGCCCTCGAGGGGA 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1129457918 15:75685477-75685499 TGAGGCCACATCCAGCGAGAAGG 0: 2
1: 4
2: 1
3: 10
4: 129
1129457910_1129457914 -7 Left 1129457910 15:75685443-75685465 CCACAAGGACGCCCTCGAGGGGA 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1129457914 15:75685459-75685481 GAGGGGAGCACCCAGGCCTGAGG 0: 1
1: 1
2: 4
3: 57
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129457910 Original CRISPR TCCCCTCGAGGGCGTCCTTG TGG (reversed) Exonic
900506365 1:3031552-3031574 TCGCCTGCTGGGCGTCCTTGTGG - Intergenic
900561616 1:3309861-3309883 CCCCCTTGAGGGAGTCCTTGAGG + Intronic
901400147 1:9010232-9010254 TCCCCTCCAGGCTGTCCTTGTGG - Exonic
903287612 1:22286580-22286602 TCCCCCAGAGGGGTTCCTTGGGG + Intergenic
905975173 1:42169020-42169042 TCCACTCCAGGGAGTCCTTTGGG - Intergenic
916655925 1:166875738-166875760 GCCCCTGGAGGGCTTCCTGGAGG - Intronic
1069780273 10:70950963-70950985 TCCCCTTGAGGGACTCCCTGGGG + Intergenic
1069827844 10:71265309-71265331 TCCCCTCTAGGGCAACCTGGCGG + Intronic
1070812596 10:79305853-79305875 TCCCCACGAGGGAGCCCTTGAGG + Intronic
1075383587 10:122038583-122038605 TTCCGTCGTGGGCGTACTTGAGG + Intronic
1077112161 11:866654-866676 TCTCCCCGTGGGCGTCCTTTTGG - Exonic
1077443429 11:2579180-2579202 TCCCCTCGAGGCCAGCCTTGAGG + Intronic
1089286125 11:117409285-117409307 TCTCTTCCAGGGCCTCCTTGAGG + Intronic
1096914820 12:55020082-55020104 TCAGCCCGAAGGCGTCCTTGAGG + Exonic
1118234832 14:63992821-63992843 TCTCCTCCAAGGCCTCCTTGAGG - Intronic
1121023244 14:90594956-90594978 TCTCCTCTTGGTCGTCCTTGTGG - Intronic
1129457910 15:75685443-75685465 TCCCCTCGAGGGCGTCCTTGTGG - Exonic
1129725895 15:77901571-77901593 TCCCCTCGAGGGCATCCGTGTGG + Intergenic
1130602903 15:85289518-85289540 TCCCTACAAGGGCGTCTTTGTGG + Intergenic
1131285828 15:91056435-91056457 TCCCTACAAGGGCGTCTTTGTGG - Intergenic
1140660650 16:77189195-77189217 TGCCCTCTAGGGATTCCTTGTGG + Intergenic
1142360833 16:89625943-89625965 TCAACACGAGGGCGTCCTGGGGG - Intronic
1148490940 17:48023787-48023809 TGCCCTCGTGGGCGACCCTGCGG - Intergenic
1152350610 17:79782094-79782116 TCCCTCCCAGGGGGTCCTTGGGG + Intronic
1152545234 17:80997114-80997136 GGCCCTCGAGGGTGGCCTTGTGG - Intronic
1152654098 17:81512130-81512152 TCCCCTGCAGGGCGTCATGGTGG - Exonic
1157362770 18:47034458-47034480 TGCCCAGGAGGGCATCCTTGGGG + Exonic
1161072940 19:2271316-2271338 ACCCCTCCAGGGCGTCCGGGCGG - Intronic
1161234267 19:3190171-3190193 AGACCTCGAGGGAGTCCTTGGGG - Intronic
1166048457 19:40243450-40243472 TCCCCTCCAGGGAGTCCTGCGGG - Intronic
934661630 2:96146272-96146294 TTCCCTCCAGGGCGGGCTTGTGG - Intergenic
934994961 2:98949479-98949501 GCCCCAAGAGGGAGTCCTTGGGG + Intergenic
937166234 2:119820511-119820533 TTCCCACCAGGGCTTCCTTGGGG - Intronic
943692357 2:190881396-190881418 TCTCCCCGGGGCCGTCCTTGGGG - Exonic
1175597809 20:60249301-60249323 TCCCCTCGATTGCTTTCTTGGGG - Intergenic
1176026311 20:62987291-62987313 TCCCCTCCAGAACGTTCTTGTGG + Intergenic
1183393655 22:37560175-37560197 TCCCCTCGTGGCCTTGCTTGGGG - Intergenic
1184094367 22:42308685-42308707 TCCCTTCAAGTGAGTCCTTGAGG + Intronic
1185319534 22:50194073-50194095 ACCCCATGAGGGCGACCTTGGGG - Intronic
1185380702 22:50506414-50506436 TGCCCTGGGGGGCCTCCTTGCGG + Exonic
961006685 3:123410267-123410289 TGCCCTGGAGGGAGTCTTTGTGG - Intronic
961500099 3:127326321-127326343 TCCCCTAGAGAGTGTCCTGGTGG - Intergenic
962198012 3:133380096-133380118 TGCCCTCGAGGGCGGCCCTCTGG - Exonic
962422682 3:135241944-135241966 TTCCCTTGAGGGCATCCTGGGGG - Intronic
962848856 3:139292933-139292955 TCCCCTCGAATGCTTCCTAGTGG + Intronic
963171707 3:142257742-142257764 TCCCCACCTGGGCCTCCTTGAGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968877972 4:3284138-3284160 TCCCCTCCAGGGCATCCTGCTGG - Intergenic
973845998 4:54913982-54914004 TGCCCTTGAAGGCGTCCTGGTGG + Intergenic
977706864 4:100081072-100081094 TCCTCCCAAGGCCGTCCTTGAGG - Intergenic
990370635 5:55114657-55114679 TCCCCTCGAGAGCCTCCCTAGGG - Intronic
1001807488 5:174600219-174600241 TGCCTTAGAGGGCTTCCTTGCGG - Intergenic
1002884414 6:1281136-1281158 TCCCCTGGAGGGCCCTCTTGGGG - Intergenic
1003873186 6:10417338-10417360 TCCCGCCGAGGGCGCCATTGAGG + Intronic
1006239457 6:32664870-32664892 TCCCCTCCAGGACTTCCTTCTGG + Exonic
1019426998 7:982660-982682 TCCCCTCATGGGCCTCCCTGAGG + Intergenic
1019780839 7:2938750-2938772 TGTCCTCCAGGGCCTCCTTGCGG + Exonic
1024255195 7:47535653-47535675 TCCCCCTCAGGGAGTCCTTGTGG - Intronic
1029291545 7:99505370-99505392 TCCCCTAGAGTGGGGCCTTGAGG + Intronic
1033608287 7:142943201-142943223 TCCCCTCCAGGCCTCCCTTGTGG + Intronic
1042591397 8:70402521-70402543 TCCCCTCGGGGGAGTCCCAGAGG - Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1046677782 8:117130775-117130797 TCACCTAGAGGGCGTTTTTGAGG + Intronic
1049644136 8:143728521-143728543 GCCTCTCGTGGGCGTCCCTGGGG - Exonic
1053157938 9:35792954-35792976 CACCATCGAGGGCGTCTTTGAGG + Exonic
1056331035 9:85521496-85521518 GCCCCTGGAAGGCGTCCTGGTGG - Intergenic
1062108935 9:134771464-134771486 TCCCCTTGAGGGAGGCTTTGAGG - Intronic
1062548845 9:137077000-137077022 TCCCCTGCGGGGCGTCCCTGGGG + Intergenic
1188006320 X:25017869-25017891 GACCCTCGCGGGCGTCCCTGCGG + Intergenic
1199466631 X:148145211-148145233 TCCCCTGGAGTACTTCCTTGGGG + Intergenic