ID: 1129461127

View in Genome Browser
Species Human (GRCh38)
Location 15:75700546-75700568
Sequence CAGACCTCCAAGTCACCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 112}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129461127_1129461140 9 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461140 15:75700578-75700600 TGGAGAGACAGGGGTCTGGGTGG 0: 2
1: 3
2: 6
3: 87
4: 557
1129461127_1129461137 0 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461137 15:75700569-75700591 GGAGGAGGGTGGAGAGACAGGGG 0: 2
1: 1
2: 20
3: 189
4: 1672
1129461127_1129461143 26 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461143 15:75700595-75700617 GGGTGGGAGCTGCCCCCAGGAGG 0: 2
1: 0
2: 2
3: 49
4: 449
1129461127_1129461141 10 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461141 15:75700579-75700601 GGAGAGACAGGGGTCTGGGTGGG 0: 2
1: 0
2: 7
3: 64
4: 559
1129461127_1129461139 6 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461139 15:75700575-75700597 GGGTGGAGAGACAGGGGTCTGGG 0: 2
1: 0
2: 8
3: 64
4: 466
1129461127_1129461138 5 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461138 15:75700574-75700596 AGGGTGGAGAGACAGGGGTCTGG 0: 2
1: 0
2: 10
3: 72
4: 657
1129461127_1129461135 -2 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461135 15:75700567-75700589 TGGGAGGAGGGTGGAGAGACAGG 0: 2
1: 0
2: 15
3: 161
4: 1281
1129461127_1129461142 23 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461142 15:75700592-75700614 TCTGGGTGGGAGCTGCCCCCAGG 0: 2
1: 0
2: 7
3: 37
4: 362
1129461127_1129461136 -1 Left 1129461127 15:75700546-75700568 CCCACTGGTGACTTGGAGGTCTG 0: 1
1: 1
2: 0
3: 8
4: 112
Right 1129461136 15:75700568-75700590 GGGAGGAGGGTGGAGAGACAGGG 0: 2
1: 1
2: 23
3: 204
4: 1623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129461127 Original CRISPR CAGACCTCCAAGTCACCAGT GGG (reversed) Intronic
902289364 1:15426579-15426601 CAGACCTCCTGGGCCCCAGTTGG - Intronic
902465998 1:16619188-16619210 CAGGCCTCTAAGCCCCCAGTGGG - Intergenic
902508693 1:16954116-16954138 CAGGCCTCTAAGCCCCCAGTGGG + Intronic
909566065 1:77054736-77054758 CAGACCTCCAGGACACCTGATGG - Intronic
913105695 1:115612224-115612246 CAGACCAGCAAGACAGCAGTAGG - Intergenic
913130610 1:115835176-115835198 CAGACCTCCCATTCACATGTAGG - Intergenic
913130792 1:115837630-115837652 GAGAACTCAAAGTCTCCAGTGGG + Exonic
920543764 1:206798784-206798806 CCGACCTCAAAGCCACCAGAAGG + Intergenic
923537487 1:234864210-234864232 CACTTCTGCAAGTCACCAGTGGG - Intergenic
923542914 1:234901522-234901544 CAGACCTCCATGGCACCTGGAGG - Intergenic
1067166713 10:43871142-43871164 CAGAGCCCCAAGTCTCCAGCGGG - Intergenic
1068417611 10:56744623-56744645 CAGACCACCAACCCACCAGAAGG - Intergenic
1071037915 10:81269341-81269363 GAGACCACCAAGCCACCAGCAGG + Intergenic
1076265987 10:129110368-129110390 CAGACCTCCAGGTCACCCCTTGG + Intergenic
1076296037 10:129385594-129385616 CTGGCCTCCAAGTCTCAAGTTGG - Intergenic
1076329577 10:129654583-129654605 CAGCCCTCCAAGCAGCCAGTGGG - Intronic
1077166543 11:1142838-1142860 CAGACCTCCAAATAATCTGTGGG + Intergenic
1077243308 11:1523364-1523386 CACACTTCCAAGTAACCAGTGGG - Intergenic
1080746208 11:35110918-35110940 CATTCCTCCAAGCCAACAGTAGG + Intergenic
1085235781 11:75014314-75014336 CAGATCTCTGAGTCACAAGTTGG + Intronic
1088714999 11:112541364-112541386 CAGATCTCTGAGTCACCATTTGG + Intergenic
1088993483 11:114975007-114975029 CAGACCACCATGTCACTAATAGG - Intergenic
1092503861 12:9074735-9074757 CAGAAACCCAAGGCACCAGTGGG - Exonic
1092510874 12:9154791-9154813 CAGAGACCCAAGGCACCAGTGGG - Exonic
1096759784 12:53831321-53831343 CAGACCTCGAAGTGATAAGTGGG - Intergenic
1098661571 12:73101038-73101060 CAGAGCTACAAGTCACCTGGGGG - Intergenic
1101499421 12:105288604-105288626 CAAACTTCCAAGTCTCCAGTTGG - Intronic
1111591197 13:90349616-90349638 CAGACCACCAACCCACCAGAAGG + Intergenic
1113808560 13:113123759-113123781 TGGAGCTCCAAGTCACCAGGCGG - Intronic
1115258416 14:31427364-31427386 CAGAAATCCTATTCACCAGTTGG + Intronic
1115388185 14:32822092-32822114 CAGTCGTCCATTTCACCAGTGGG + Exonic
1118434334 14:65755755-65755777 CATAGCTCCAAGTCACAAGCAGG - Intergenic
1119075714 14:71636427-71636449 CAGATTTCTAAGTAACCAGTAGG + Intronic
1119160760 14:72450837-72450859 CAAACATCCAAATCACCAGCAGG - Intronic
1119303549 14:73589939-73589961 CAGACCACGAACTCACCAGGAGG - Intergenic
1123778291 15:23601878-23601900 AAGATAACCAAGTCACCAGTGGG + Intronic
1124598060 15:31107793-31107815 CATACTTCTAAGTAACCAGTGGG - Intronic
1129461127 15:75700546-75700568 CAGACCTCCAAGTCACCAGTGGG - Intronic
1129723703 15:77891196-77891218 CAGACCTCCAAGTCCCCAGTGGG + Intergenic
1138729121 16:59175560-59175582 AGGCCCTGCAAGTCACCAGTTGG + Intergenic
1139415187 16:66801983-66802005 CAGGCCTCCACCTCACCAGGGGG + Intergenic
1140111977 16:72012353-72012375 CAGAACCCCAAGTGAGCAGTGGG + Intronic
1142865783 17:2790732-2790754 CAGACCTCATAGCCACCAGTGGG - Intronic
1143009071 17:3855766-3855788 CAGATCACAAAGTCACAAGTTGG - Intergenic
1143441838 17:6980799-6980821 GAGTCCTCCAATTCACAAGTTGG - Intronic
1145833977 17:27939927-27939949 CATCCCTCCCAGTCACCTGTTGG - Intergenic
1146503825 17:33387384-33387406 CAGATGTCCAAGTCAGCAGAGGG + Intronic
1149048034 17:52270296-52270318 CAGACCTCCAACTTCCCTGTAGG - Intergenic
1153649948 18:7231004-7231026 AGGACCTCCTAGTCACAAGTTGG + Intergenic
1156112065 18:33740234-33740256 GAGCCCTCCAAGTCACCTGATGG + Exonic
1156258530 18:35422759-35422781 CAGGCCACCAATTCACCAGGTGG + Intergenic
1156410311 18:36821923-36821945 CAGGCATCCCAGTCACCAGAGGG - Intronic
1161312428 19:3602350-3602372 CACACCCCCAAGTCACCTGGAGG + Intronic
1166007034 19:39915118-39915140 CAGAACTCCAAGTCTTCAGAGGG + Intronic
1167508615 19:49884052-49884074 CAGGCCTCCCACTCACCAGCTGG - Intronic
929020681 2:37549600-37549622 GAGAACCTCAAGTCACCAGTGGG - Intergenic
931799222 2:65742233-65742255 CAGCCAGACAAGTCACCAGTAGG - Intergenic
932547130 2:72724905-72724927 AAGATCTTCAAGTCACCTGTGGG + Intronic
932771319 2:74502317-74502339 CAGGCCTCCGTGCCACCAGTGGG - Intronic
935789389 2:106577161-106577183 CAGACCACCAACCCACCAGCAGG - Intergenic
936051259 2:109225475-109225497 CAGCCCACCCAGTCCCCAGTGGG - Intronic
936527615 2:113252342-113252364 CAGACCTGCAAGTGAGCAGCTGG - Intronic
937158695 2:119740191-119740213 CACACCTGCAGGTCACCCGTTGG - Intergenic
938691821 2:133799183-133799205 CAGACTTAGAAGTCAGCAGTAGG + Intergenic
943750297 2:191503424-191503446 CTCACCTCCTAGGCACCAGTAGG + Intergenic
944341577 2:198606737-198606759 AATACCTCCAAGTCAACATTTGG + Intergenic
946001572 2:216486776-216486798 CAGACCACCAGGGCACCACTGGG - Intergenic
1171255399 20:23686159-23686181 CAAGGCTCCAAGTCACCAGGTGG + Intronic
1171262742 20:23748081-23748103 CAAGGCTCCAAGTCACCAGGTGG + Intronic
1171271879 20:23824285-23824307 CAAGGCTCCAAGTCACCAGGTGG + Intronic
1171283319 20:23919036-23919058 CAAGGCTCCAAGTCACCAGGTGG + Intergenic
1173681267 20:44884213-44884235 CAGACTTCTAATTCACCATTTGG - Intergenic
1176067343 20:63205096-63205118 CAGTCCCCCAAGTAACCAGAAGG + Intronic
1182260872 22:29072741-29072763 CCGGCCTCCAAGTCACCAAGCGG - Intergenic
950440087 3:13005430-13005452 CAGTCCTCCAAGGCAGCAGCTGG + Intronic
952931667 3:38365552-38365574 CAGATCTCCAAGTCAGCGGATGG + Intronic
953038905 3:39237620-39237642 CATACCTCCCAGGCACCAGTGGG - Intergenic
955201302 3:56854546-56854568 CAGATCTCCAAGTTAGCAGCAGG + Intronic
962083217 3:132162814-132162836 CAGACCTCTAAGTAACCATTTGG - Intronic
964704288 3:159601842-159601864 CAGACCTCCAAGTGGTCACTGGG + Intronic
967421273 3:189275894-189275916 CATACCTCAAAGTCTTCAGTGGG + Intronic
968731258 4:2270415-2270437 CAGATCTCCGAGGGACCAGTGGG + Exonic
969781744 4:9409743-9409765 AAGATCTCCAAGTCCCCAGCCGG + Intergenic
973720296 4:53717135-53717157 CAGACCTCTGACTCAGCAGTTGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
977525019 4:98133758-98133780 CAGACCTTTAACTCACCTGTTGG - Intronic
977993871 4:103478758-103478780 CTGACCTCCAGGGCACCATTTGG + Intergenic
985745673 5:1645449-1645471 CAGACATCCAACTCGCCAGCAGG + Intergenic
985774608 5:1834235-1834257 CAGAACTCCAAGACGCCAGGTGG - Intergenic
987036854 5:14027724-14027746 CAGACCTTGAAGTCACTAGAAGG + Intergenic
988578425 5:32447900-32447922 CACACCTACAAGTCAAAAGTAGG + Intergenic
988896764 5:35683136-35683158 CAGAACTCCAGGTCACCATTAGG + Intronic
995175637 5:109173399-109173421 GAGGCATCCAAGCCACCAGTAGG + Intronic
995648432 5:114339880-114339902 CAGACCTCCATGACAACAGAAGG + Intergenic
1001954283 5:175837709-175837731 TAGACAGCCAAGTCACCATTTGG - Intronic
1010370430 6:75100715-75100737 AACACCTCCAAGACACCATTGGG - Intronic
1011344782 6:86357378-86357400 CATCCCTCAAAGTCACCACTTGG + Intergenic
1012903740 6:105039068-105039090 TAGATCTCAAAGCCACCAGTGGG - Intronic
1015786585 6:136924555-136924577 CAGAGCTCCCAGCCACCAGCGGG - Exonic
1019494383 7:1330955-1330977 CAGCTCTCCAAGTAATCAGTCGG + Intergenic
1024063602 7:45716018-45716040 CTGCCCTCAAAGTCTCCAGTGGG - Exonic
1026187232 7:68091402-68091424 CAGACCACAAAGTCAGGAGTTGG - Intergenic
1037599384 8:20381086-20381108 CCCACCTCCAAGTCACCAGCAGG - Intergenic
1043183037 8:77108933-77108955 CAAACCTTCTAGTCAACAGTAGG - Intergenic
1046500934 8:115075655-115075677 CACAACTCCATGTTACCAGTCGG + Intergenic
1048192540 8:132302836-132302858 TAGACATCCAAATCACCTGTGGG - Intronic
1048303659 8:133268606-133268628 CAGACCTCCATGCCACCGGGAGG + Intronic
1050720410 9:8582637-8582659 CAGCCCTACTAGGCACCAGTGGG + Intronic
1052997561 9:34559372-34559394 CAGAACTCCAGGGCACCAGGTGG + Intronic
1056543511 9:87594403-87594425 CAGACTTGCAAGTGCCCAGTGGG - Intronic
1059615494 9:115946551-115946573 CAGACCTCCATATATCCAGTGGG + Intergenic
1060134619 9:121140800-121140822 AAGACCTCCAAGTCTAGAGTGGG + Intronic
1061532728 9:131227817-131227839 CAGACCTCCAAGAGCCCACTCGG - Intronic
1062096269 9:134705544-134705566 CGGGGCTCCAAGTCACCAGCAGG - Intronic
1062418222 9:136464673-136464695 CAGACTTCCAACTCAAAAGTCGG + Intronic
1062601298 9:137319739-137319761 CAGCCTTCCAGGTCACCAGGTGG - Intronic
1186095411 X:6096160-6096182 TAGCTCTCCAAGTCACCACTAGG - Intronic
1188041680 X:25376374-25376396 CAGACCACCAAGTCCCTAGGAGG - Intergenic
1192829572 X:74737158-74737180 CAGACCTCAGAGTCACCTGCTGG - Exonic
1195681086 X:107547168-107547190 CCGAGGTCCAAGTCACCAGGAGG + Intronic
1199845567 X:151690490-151690512 CAGAAAGCCAAGCCACCAGTTGG - Intergenic
1200213435 X:154356941-154356963 GAGACCCCAAAGTCCCCAGTGGG + Intronic