ID: 1129462522

View in Genome Browser
Species Human (GRCh38)
Location 15:75706731-75706753
Sequence GGTTGTGGATTATTATCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129462516_1129462522 21 Left 1129462516 15:75706687-75706709 CCTGTTGCATGGAGCAGCTTGAG 0: 2
1: 0
2: 0
3: 15
4: 138
Right 1129462522 15:75706731-75706753 GGTTGTGGATTATTATCTGATGG 0: 1
1: 1
2: 1
3: 6
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129462522 Original CRISPR GGTTGTGGATTATTATCTGA TGG Intronic
905829148 1:41050304-41050326 GGTTGTGGCTCACTAGCTGAAGG + Intronic
907812740 1:57888242-57888264 GAATGTGCATTTTTATCTGATGG - Intronic
907859300 1:58335692-58335714 GGATGGGGATTATACTCTGAGGG + Intronic
908439075 1:64135340-64135362 GGTTGGGGATTTATATCTGGGGG + Intronic
908964909 1:69748869-69748891 GTTTCTGGAATAATATCTGAAGG - Intronic
909875909 1:80802709-80802731 GTTTGTGGAATATTCTCTCAGGG + Intergenic
910806517 1:91193963-91193985 TGGTCTGGATTATTACCTGATGG - Intergenic
918685066 1:187404293-187404315 GTTGGTGGAAAATTATCTGATGG - Intergenic
919124115 1:193376046-193376068 GGTTGTGGTTTTTTACCTGGTGG + Intergenic
924316776 1:242806050-242806072 GGTTGGGGATTTTTATGTGTGGG + Intergenic
1065872470 10:29967300-29967322 GTTTGTGGATCATTTTCAGATGG - Intergenic
1068351136 10:55847073-55847095 GGTTGTGCATAATTAAATGATGG + Intergenic
1078142981 11:8705033-8705055 GATTTTGGATTCTCATCTGATGG - Intronic
1082999915 11:59281784-59281806 GGTTGTGGATTTTTTCCTGGTGG - Intergenic
1085478929 11:76805925-76805947 GGTTGTCGATTCATATCTGTAGG + Intergenic
1086086410 11:82959522-82959544 GGTTCTCTATCATTATCTGAAGG - Intronic
1086412116 11:86553421-86553443 CTTTGTGGATTAGCATCTGAAGG - Intronic
1086913770 11:92504068-92504090 GATTGTGAATTATTATGTAATGG + Intronic
1087767295 11:102169439-102169461 AGTTCTGGATTATTATAAGATGG + Intronic
1090209215 11:124906136-124906158 GGTTGTGGTTTTTTTCCTGATGG + Intergenic
1091821903 12:3481635-3481657 GGTTATGGAGTATTGACTGAGGG + Intronic
1093287114 12:17277403-17277425 GGATTTAGATTGTTATCTGAAGG + Intergenic
1093945846 12:25108882-25108904 GGTAGCAGATTATTATTTGAAGG + Intronic
1098035482 12:66297542-66297564 GGTGGAGGAGTATTATGTGATGG + Intergenic
1099730571 12:86494910-86494932 CATTGTCGATTATCATCTGATGG - Intronic
1101031567 12:100665628-100665650 GGTTATGTATTTTTATATGAAGG + Intergenic
1101481250 12:105099687-105099709 GTTTGTGGCTTTTTGTCTGATGG - Intergenic
1104390350 12:128386507-128386529 GGTTGTGGAGAATTAACTCAGGG + Intronic
1106300895 13:28464328-28464350 GGTTGTGGACTATTACAGGAAGG + Intronic
1110459566 13:75730420-75730442 GGTTTTGTAGTATTCTCTGATGG + Intronic
1110573563 13:77031329-77031351 GGGTGTGGCTTTTTTTCTGATGG + Intergenic
1110815836 13:79859072-79859094 GGTTGTGGTTTTTTACCTGGTGG - Intergenic
1111505875 13:89187011-89187033 GTTTGTGGAGTAATGTCTGAGGG + Intergenic
1111536048 13:89604692-89604714 GGTGGTGGTTTTTTATCTGGTGG + Intergenic
1111638515 13:90936847-90936869 AGTTGTGGAATATTATCTTCTGG - Intergenic
1114016586 14:18435436-18435458 TGTTCTGGATTCCTATCTGAGGG + Intergenic
1114017998 14:18449524-18449546 TGTTCTGGAATATTATGTGAGGG + Intergenic
1114018007 14:18449616-18449638 TGTTCTGGATTATTATGTGAGGG + Intergenic
1114019616 14:18465928-18465950 GGTTCTGGAATGTTATGTGATGG + Intergenic
1114020074 14:18470192-18470214 TGTTCTGGATTGTTATGTGAAGG + Intergenic
1114021242 14:18480967-18480989 TGTTCTGGAATATTATGTGAAGG - Intergenic
1114021329 14:18481830-18481852 TGTTCTGGAATGTTATCTGAGGG - Intergenic
1114024322 14:18511041-18511063 TGTTCTGGAATACTATCTGAGGG - Intergenic
1114024692 14:18514332-18514354 GGTTCTGGAAACTTATCTGAGGG - Intergenic
1114024910 14:18516588-18516610 TGTTCTGGAATAATATCTGAGGG - Intergenic
1114025619 14:18523519-18523541 TGTTCTGGAATCTTATCTGAGGG - Intergenic
1114026280 14:18529877-18529899 GGTTCTGGAATGCTATCTGAGGG - Intergenic
1116166268 14:41337817-41337839 GGGTTTGTATTATTCTCTGATGG + Intergenic
1121907833 14:97763664-97763686 AGGGGTGGATTATTATCAGAGGG + Intronic
1202886256 14_KI270722v1_random:110147-110169 TGTTCTGGATTTTTATGTGATGG + Intergenic
1202886882 14_KI270722v1_random:115920-115942 TGTTCTGGAATATTATGTGAGGG + Intergenic
1129462522 15:75706731-75706753 GGTTGTGGATTATTATCTGATGG + Intronic
1129722341 15:77884683-77884705 GGTTATGGATTATTATCTGATGG - Intergenic
1131192506 15:90328192-90328214 AGTTGATGCTTATTATCTGAGGG + Intergenic
1131364747 15:91828830-91828852 GGTTGTGTCTTATTATCTCCAGG - Intergenic
1138858678 16:60727972-60727994 GGTTGTGCATAGTTATATGAGGG - Intergenic
1203156418 17_GL000205v2_random:8105-8127 TGTTCTGGAATATTATATGAGGG + Intergenic
1203157287 17_GL000205v2_random:16387-16409 GGTTCTGGAATCTTATGTGAGGG + Intergenic
1203158677 17_GL000205v2_random:29135-29157 GGTTCTGGATTCCTATGTGAGGG + Intergenic
1203159374 17_GL000205v2_random:35118-35140 GGTTCTGGAATCTTATGTGAGGG + Intergenic
1156836646 18:41563125-41563147 GGTTGTGGGTTAATATTTGAAGG + Intergenic
1159262055 18:66026873-66026895 GGTTATGGGTCTTTATCTGATGG + Intergenic
1159471454 18:68861841-68861863 TGTTGTGATTCATTATCTGAAGG + Intronic
1162902111 19:13801262-13801284 GGTTCGGGATTATGAGCTGAAGG + Intronic
1163534429 19:17869049-17869071 GGGTGTGGATTTTGTTCTGAGGG - Intergenic
1164814256 19:31182348-31182370 AGCTGAGGATTATTGTCTGAGGG - Intergenic
1202661720 1_KI270708v1_random:77641-77663 TGTTCTGGATTTTTATGTGATGG + Intergenic
1202662305 1_KI270708v1_random:82866-82888 TGTTCTGGAATATTATGTGAGGG + Intergenic
929013403 2:37470469-37470491 GGTTGTAGATTCTTATCTCTGGG + Intergenic
929050036 2:37828641-37828663 GGTTGATGATTATTATTTCAAGG + Intergenic
930152275 2:48070792-48070814 GGTTTTGAATGATTAACTGAAGG + Intergenic
931707945 2:64963446-64963468 GGTTGTGGATTTTTACCTTGTGG + Intergenic
933753809 2:85621363-85621385 GGTTGTGAACTGTTTTCTGAAGG + Intronic
940958800 2:159759005-159759027 GGTGGTGGCTTATTATCATAGGG + Intronic
941643336 2:168012736-168012758 GGTTGTTGATTTTTATGTTATGG - Intronic
942490371 2:176483881-176483903 TGTTGGGCATGATTATCTGAAGG + Intergenic
942941865 2:181628275-181628297 GGTTATGGAGAATTATCTGGAGG - Intronic
944597981 2:201279543-201279565 GGATGTGGCTTGTTCTCTGAGGG - Intronic
945717574 2:213378753-213378775 GGTTGTGGATTTTTTCCTGGTGG + Intronic
1169554747 20:6737298-6737320 GCTTGTGCAATCTTATCTGAAGG + Intergenic
1170002251 20:11627666-11627688 TATTATGGCTTATTATCTGAAGG + Intergenic
1180301971 22:11043566-11043588 GGATGTGGATTTTTTTTTGAGGG - Intergenic
1180329121 22:11460408-11460430 TGTTCTGGAATATTATGTGAGGG + Intergenic
1180441092 22:15366309-15366331 TGTTCTGGATTCCTATCTGAGGG + Intergenic
1180441095 22:15366357-15366379 TGTTCTGGAATCTTATCTGACGG + Intergenic
1180442507 22:15380394-15380416 TGTTCTGGAATATTATGTGAGGG + Intergenic
1180442516 22:15380486-15380508 TGTTCTGGATTATTATGTGAGGG + Intergenic
1180444119 22:15396753-15396775 GGTTCTGGAATGTTATGTGATGG + Intergenic
1180444580 22:15401017-15401039 TGTTCTGGATTGTTATGTGAAGG + Intergenic
1180445701 22:15411313-15411335 TGTTCTGGAATATTATGTGAAGG - Intergenic
1180445784 22:15412176-15412198 TGTTCTGGAATGTTATCTGAGGG - Intergenic
1180448488 22:15438568-15438590 TGTTCTGGAATACTATCTGAGGG - Intergenic
1180448852 22:15441813-15441835 GGTTCTGGAAACTTATCTGAGGG - Intergenic
1180449076 22:15444069-15444091 TGTTCTGGAATAATATCTGAGGG - Intergenic
1180449803 22:15451144-15451166 TGTTCTGGAATCTTATCTGAGGG - Intergenic
1180450401 22:15456930-15456952 GGTTCTGGAATGCTATCTGAGGG - Intergenic
1180523395 22:16231251-16231273 TGTTCTGGAATATTATGTGAGGG + Intergenic
1182553895 22:31118373-31118395 GGTTGGGGATTAGTCTGTGATGG + Intronic
1182939405 22:34260586-34260608 CATGGTGGATTATTACCTGAAGG + Intergenic
951554845 3:23910858-23910880 GTTTGTGGATTGTTATCTGTGGG - Exonic
953324510 3:42001563-42001585 GGTTCTGGATTATATTTTGAAGG + Intergenic
957093203 3:75752269-75752291 TGTTCTGGAATCTTATCTGAGGG - Intronic
962967928 3:140371438-140371460 GGGTGTGCATTAGTCTCTGAGGG - Intronic
965169394 3:165241907-165241929 GGTTGCCAATTATTCTCTGATGG + Intergenic
968859837 4:3158676-3158698 GTATGTGGCTTATTTTCTGAAGG + Intronic
973101362 4:46275332-46275354 TGTTGTAGATTATGATTTGATGG - Intronic
973120750 4:46518999-46519021 GGTTGTGGTTTTCTACCTGATGG + Intergenic
973802291 4:54491535-54491557 GGTTTTGGCTTCTTATCTGGTGG - Intergenic
978958354 4:114642866-114642888 TTTTGTGAATTATTATCTGTGGG + Intronic
981433295 4:144688066-144688088 GGTTTTGGATGGTTATTTGATGG - Intronic
985076395 4:186219716-186219738 GGTTGTGGTTTTTTACCTGGTGG + Intronic
985811943 5:2096773-2096795 GGTTTTGGATGTTTACCTGAAGG - Intergenic
986725778 5:10595246-10595268 GGCAGTGGATTTTTTTCTGAAGG + Intronic
986916876 5:12631147-12631169 GTTAATGGCTTATTATCTGAAGG - Intergenic
990669377 5:58110541-58110563 GGTTTTTTGTTATTATCTGAGGG - Intergenic
992735776 5:79719053-79719075 GGTTCTCTATTTTTATCTGAAGG - Intronic
993189568 5:84664101-84664123 GTCTGTGGCTTATTATCTAAAGG + Intergenic
993820985 5:92616647-92616669 GCTTGTACATTTTTATCTGAAGG + Intergenic
994247855 5:97501019-97501041 GTTTGTGGGTTAATATCTGTGGG + Intergenic
995400645 5:111737140-111737162 GATGGTGGATTACTTTCTGAAGG - Intronic
995835877 5:116399201-116399223 GGGTGTGGATTCATTTCTGAAGG + Intronic
996018829 5:118569788-118569810 GGATGTGGTTTTTTACCTGATGG - Intergenic
1002908702 6:1471787-1471809 GGATGTGGAGTGTTATCTGCAGG - Intergenic
1005451870 6:25981643-25981665 GCTTATGGAACATTATCTGAGGG + Intronic
1006691717 6:35893497-35893519 GGTGGGGGATGATTAACTGAAGG + Intronic
1009770108 6:68134936-68134958 GGTCGTGGCTTTTTATCTGGTGG + Intergenic
1016766285 6:147797859-147797881 GGTTTTGTAGTATTCTCTGATGG + Intergenic
1016886161 6:148961687-148961709 GGTTGTGGAATCTTCTCTCAAGG + Intronic
1018917205 6:168141432-168141454 GGTTCTGTATTCTTTTCTGATGG + Intergenic
1019087560 6:169494403-169494425 TGGTGTGGATTATAGTCTGAAGG - Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021493326 7:21244732-21244754 GTTTCTGGATTATAACCTGAAGG + Intergenic
1024527693 7:50362792-50362814 GGTTGAGGATGATAATCTTAGGG + Intronic
1024866363 7:53908262-53908284 GGTTGTGGTTTTTTACCTGGTGG - Intergenic
1026207879 7:68273940-68273962 GGTTGTGGTTCATTATCTGATGG - Intergenic
1027749929 7:82130248-82130270 CTTTGTGAATTATTATCTTAGGG - Intronic
1028963761 7:96778651-96778673 TGTTGTGGAGTGTTACCTGATGG - Intergenic
1041766955 8:61428818-61428840 AGTTGTGGATCAATATCTGTGGG - Intronic
1044086009 8:87942902-87942924 GGTTGTGGATGATGAACTCAAGG - Intergenic
1044285706 8:90410535-90410557 GGTTGTGGTTTTTTACCTGGTGG + Intergenic
1045546024 8:103129279-103129301 GGTTGTTGATTGTTCTCTAAAGG + Intergenic
1045843863 8:106610451-106610473 GGATTTGGATTTTGATCTGAGGG - Intronic
1051371485 9:16362949-16362971 GGTTATGCATTCTTATGTGATGG - Intergenic
1053719013 9:40926429-40926451 TGTTCTGGAATATTATGTGAAGG - Intergenic
1057499125 9:95582765-95582787 GGTTGGGGAATATTATTTTAAGG + Intergenic
1059986918 9:119829389-119829411 GTTTGTGGAATATTAAATGAGGG + Intergenic
1203492479 Un_GL000224v1:119926-119948 TGTTCCGGAATATTATCTGAGGG - Intergenic
1203494478 Un_GL000224v1:138021-138043 TGTTGTGGAATATTATGTAACGG - Intergenic
1203495541 Un_GL000224v1:147889-147911 GATTGTGGAATCCTATCTGAGGG - Intergenic
1203497320 Un_GL000224v1:164312-164334 TGTTCTGGAATCTTATCTGAGGG + Intergenic
1203497767 Un_GL000224v1:168633-168655 TGTTCTGGAATATTATGTGAGGG + Intergenic
1203498065 Un_GL000224v1:171688-171710 TGTTGTGGAATCTTATGTGAGGG + Intergenic
1203505102 Un_KI270741v1:61798-61820 TGTTCCGGAATATTATCTGAGGG - Intergenic
1203507097 Un_KI270741v1:79896-79918 TGTTGTGGAATATTATGTAACGG - Intergenic
1203508166 Un_KI270741v1:89812-89834 GATTGTGGAATCCTATCTGAGGG - Intergenic
1203509879 Un_KI270741v1:106368-106390 TGTTCTGGAATCTTATCTGAGGG + Intergenic
1203510318 Un_KI270741v1:110883-110905 TGTTCTGGAATATTATGTGAGGG + Intergenic
1203510619 Un_KI270741v1:113938-113960 TGTTGTGGAATCTTATGTGAGGG + Intergenic
1186364676 X:8878895-8878917 GTTTTTGGATTATTTTCTTAAGG - Intergenic
1190473788 X:50808660-50808682 GGTTATGGATGATTATCTGGAGG - Intronic
1190813804 X:53910353-53910375 GGTTGCTGAGTAGTATCTGATGG + Intergenic
1193381847 X:80824986-80825008 GGTTTTGTAGTATTCTCTGATGG + Intergenic
1196181542 X:112696935-112696957 GGTTCTGGATTTTTATTTGTTGG + Intergenic
1196372416 X:114994668-114994690 GGTTGTGGTTTATTTCCTGGTGG + Intergenic
1197294388 X:124700137-124700159 GGTTTTGTATTTTTATCTGAAGG - Intronic
1200917306 Y:8582642-8582664 GGTTGTGGGTCATTGTCTCATGG + Intergenic
1202087961 Y:21158624-21158646 GGTTTTGTAGTATTCTCTGATGG + Intergenic