ID: 1129462950

View in Genome Browser
Species Human (GRCh38)
Location 15:75709077-75709099
Sequence TCCGTAACTCCAAACAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129462950_1129462956 4 Left 1129462950 15:75709077-75709099 CCTCTCCTGTTTGGAGTTACGGA 0: 2
1: 0
2: 0
3: 9
4: 68
Right 1129462956 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1129462950_1129462958 23 Left 1129462950 15:75709077-75709099 CCTCTCCTGTTTGGAGTTACGGA 0: 2
1: 0
2: 0
3: 9
4: 68
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462950_1129462957 20 Left 1129462950 15:75709077-75709099 CCTCTCCTGTTTGGAGTTACGGA 0: 2
1: 0
2: 0
3: 9
4: 68
Right 1129462957 15:75709120-75709142 AGCTAGGAACCCTTGCCCCACGG 0: 1
1: 0
2: 3
3: 11
4: 111
1129462950_1129462952 -7 Left 1129462950 15:75709077-75709099 CCTCTCCTGTTTGGAGTTACGGA 0: 2
1: 0
2: 0
3: 9
4: 68
Right 1129462952 15:75709093-75709115 TTACGGACCCTCCTGAGAAGCGG 0: 2
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129462950 Original CRISPR TCCGTAACTCCAAACAGGAG AGG (reversed) Intronic