ID: 1129462951

View in Genome Browser
Species Human (GRCh38)
Location 15:75709082-75709104
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129462951_1129462957 15 Left 1129462951 15:75709082-75709104 CCTGTTTGGAGTTACGGACCCTC 0: 2
1: 0
2: 0
3: 2
4: 36
Right 1129462957 15:75709120-75709142 AGCTAGGAACCCTTGCCCCACGG 0: 1
1: 0
2: 3
3: 11
4: 111
1129462951_1129462956 -1 Left 1129462951 15:75709082-75709104 CCTGTTTGGAGTTACGGACCCTC 0: 2
1: 0
2: 0
3: 2
4: 36
Right 1129462956 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1129462951_1129462958 18 Left 1129462951 15:75709082-75709104 CCTGTTTGGAGTTACGGACCCTC 0: 2
1: 0
2: 0
3: 2
4: 36
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129462951 Original CRISPR GAGGGTCCGTAACTCCAAAC AGG (reversed) Intronic