ID: 1129462952

View in Genome Browser
Species Human (GRCh38)
Location 15:75709093-75709115
Sequence TTACGGACCCTCCTGAGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129462947_1129462952 29 Left 1129462947 15:75709041-75709063 CCTGAAGGTAAGAGCACAGCAAT 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1129462952 15:75709093-75709115 TTACGGACCCTCCTGAGAAGCGG 0: 2
1: 0
2: 0
3: 4
4: 55
1129462950_1129462952 -7 Left 1129462950 15:75709077-75709099 CCTCTCCTGTTTGGAGTTACGGA 0: 2
1: 0
2: 0
3: 9
4: 68
Right 1129462952 15:75709093-75709115 TTACGGACCCTCCTGAGAAGCGG 0: 2
1: 0
2: 0
3: 4
4: 55
1129462946_1129462952 30 Left 1129462946 15:75709040-75709062 CCCTGAAGGTAAGAGCACAGCAA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1129462952 15:75709093-75709115 TTACGGACCCTCCTGAGAAGCGG 0: 2
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129462952 Original CRISPR TTACGGACCCTCCTGAGAAG CGG Intronic