ID: 1129462955

View in Genome Browser
Species Human (GRCh38)
Location 15:75709104-75709126
Sequence CCTAGCTCTCTCCGCTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129462955_1129462957 -7 Left 1129462955 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG 0: 1
1: 0
2: 1
3: 9
4: 161
Right 1129462957 15:75709120-75709142 AGCTAGGAACCCTTGCCCCACGG 0: 1
1: 0
2: 3
3: 11
4: 111
1129462955_1129462958 -4 Left 1129462955 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG 0: 1
1: 0
2: 1
3: 9
4: 161
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129462955 Original CRISPR CCTAGCTCTCTCCGCTTCTC AGG (reversed) Intronic