ID: 1129462956

View in Genome Browser
Species Human (GRCh38)
Location 15:75709104-75709126
Sequence CCTGAGAAGCGGAGAGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129462951_1129462956 -1 Left 1129462951 15:75709082-75709104 CCTGTTTGGAGTTACGGACCCTC 0: 2
1: 0
2: 0
3: 2
4: 36
Right 1129462956 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1129462950_1129462956 4 Left 1129462950 15:75709077-75709099 CCTCTCCTGTTTGGAGTTACGGA 0: 2
1: 0
2: 0
3: 9
4: 68
Right 1129462956 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129462956 Original CRISPR CCTGAGAAGCGGAGAGAGCT AGG Intronic