ID: 1129462958

View in Genome Browser
Species Human (GRCh38)
Location 15:75709123-75709145
Sequence TAGGAACCCTTGCCCCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129462955_1129462958 -4 Left 1129462955 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG 0: 1
1: 0
2: 1
3: 9
4: 161
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462950_1129462958 23 Left 1129462950 15:75709077-75709099 CCTCTCCTGTTTGGAGTTACGGA 0: 2
1: 0
2: 0
3: 9
4: 68
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462951_1129462958 18 Left 1129462951 15:75709082-75709104 CCTGTTTGGAGTTACGGACCCTC 0: 2
1: 0
2: 0
3: 2
4: 36
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462954_1129462958 -1 Left 1129462954 15:75709101-75709123 CCTCCTGAGAAGCGGAGAGAGCT 0: 1
1: 1
2: 0
3: 18
4: 216
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462953_1129462958 0 Left 1129462953 15:75709100-75709122 CCCTCCTGAGAAGCGGAGAGAGC 0: 1
1: 1
2: 1
3: 12
4: 194
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129462958 Original CRISPR TAGGAACCCTTGCCCCACGG AGG Intronic
908786100 1:67736186-67736208 TAGGAACCCTGGCTCCACAAAGG + Intronic
921453151 1:215334151-215334173 TGGGAACCACTGCCCCACAGTGG + Intergenic
1069044028 10:63723773-63723795 GAGGAACCCCTGACCCACTGGGG + Intergenic
1069627186 10:69875555-69875577 TGGGAACCCTGGCTCCACCGAGG - Intronic
1073180406 10:101579810-101579832 GAGGAACCCTGGCCCAACAGAGG + Exonic
1082651592 11:55800498-55800520 TAGGTACACTTGCCTCATGGGGG - Intergenic
1083755281 11:64788822-64788844 AGGGCACCCTTGCCCCACGTAGG - Intronic
1084179658 11:67440018-67440040 CAGGAAACCTTGCGCCAGGGAGG - Intronic
1089593726 11:119561343-119561365 TGGGAACCCTTCCCCCACATGGG + Intergenic
1089671499 11:120060356-120060378 TAGCAGTCCTTTCCCCACGGAGG - Intergenic
1091220519 11:133927625-133927647 TAGGGATCCTGGCCCCACTGTGG - Intronic
1098145884 12:67497569-67497591 GAGCAACCCTTGCCCAACAGGGG - Intergenic
1109396898 13:61771084-61771106 TAGGAATCCATGACCCACTGGGG + Intergenic
1122399145 14:101457400-101457422 TGGGACCCCCCGCCCCACGGCGG - Intergenic
1122888819 14:104723463-104723485 TGGGAACCTGGGCCCCACGGTGG + Intergenic
1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG + Intronic
1123000945 14:105293767-105293789 TTGGAAGCCAGGCCCCACGGGGG - Intronic
1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG + Intronic
1129721914 15:77882278-77882300 TAGATACCCTTGCCCCATGGAGG - Intergenic
1133703415 16:8330874-8330896 TAGGAACCTTTGGCTCAGGGAGG + Intergenic
1158616042 18:58987919-58987941 TAGGAACACTTGACCTAGGGTGG + Intergenic
1160544424 18:79643286-79643308 CAGGAACCCAAGCCCCATGGGGG + Intergenic
1160807409 19:998569-998591 TAGGAACTCTTGCTCCTCAGAGG + Intergenic
1162547396 19:11339088-11339110 CAGGAAACCTTTCCCCACGCAGG + Intronic
1163630462 19:18415647-18415669 GAGGAACCCTTGGCCAAAGGAGG + Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
924973270 2:150874-150896 TAAGAACCACTGCCCCACAGTGG - Intergenic
926063646 2:9820502-9820524 AAACAACCCATGCCCCACGGAGG + Intergenic
927161593 2:20268011-20268033 CAGCACCCCTTGCCCCGCGGAGG - Intronic
948429303 2:237909071-237909093 AATGAGCCCTTGCCCCATGGGGG - Intronic
1173118382 20:40268129-40268151 TTGGCACCCTTGCCTCAAGGTGG - Intergenic
1173154909 20:40600654-40600676 TAGGAACCTTAGCCCCACCCTGG - Intergenic
1173249365 20:41356631-41356653 CAGGTACCCTGGCCCCAAGGAGG + Intronic
1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG + Intronic
1178507246 21:33171921-33171943 GAGGAACTCCTGCCCCAAGGAGG + Intergenic
1182120315 22:27782156-27782178 TAGGAACACGTGCCCGATGGTGG + Intronic
1183295547 22:37027316-37027338 TAGTAACCCCTGCCTCAAGGTGG + Intronic
1185126392 22:49013197-49013219 TGGGAACTGTGGCCCCACGGAGG + Intergenic
953508940 3:43515824-43515846 AAGGAAACCTTGCCCCAGGCTGG - Intronic
954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG + Intronic
955417757 3:58708560-58708582 TATGAACCCTGGCCCCAAGGAGG + Intergenic
960636923 3:119793423-119793445 TGGGATCGCTTGGCCCACGGTGG - Intronic
965838143 3:172873734-172873756 TAGCAACCATTTCCCCAGGGAGG - Intergenic
969602158 4:8182883-8182905 TGGGAACCCTGGCCCCATGAGGG - Intronic
1000106123 5:158060637-158060659 GAGGATCCCTTGACCCAAGGAGG + Intergenic
1002721140 5:181261908-181261930 TCGGAACCCTGGCCCGACGCAGG - Intergenic
1013409857 6:109874340-109874362 TAGGAACCCTTGCCAGAGAGTGG + Intergenic
1020888490 7:13849616-13849638 TAGGAACCCTGACACCACTGCGG + Intergenic
1022559749 7:31336260-31336282 TCGGCACCTTTGCCCCTCGGTGG + Intergenic
1023629108 7:42145912-42145934 TAGGAATCCTTTCCTCACTGTGG - Intronic
1030694869 7:112573897-112573919 TCAGAACCCATCCCCCACGGAGG - Intergenic
1031483215 7:122302196-122302218 CAGAAACCCTTGCCGCACGTGGG + Exonic
1033834723 7:145295681-145295703 TAGGAAACCTTGCTCCACTGAGG - Intergenic
1036664548 8:10730309-10730331 TCGGAGCCCTTGTCCCCCGGGGG + Intronic
1038349862 8:26766058-26766080 TCTGAACCCTTTCTCCACGGTGG + Intronic
1038780943 8:30568184-30568206 TAGGAACCTTTGCCACATGATGG + Intronic
1049528266 8:143140525-143140547 CAGGAACCCTTGCCCCATCCTGG - Intergenic
1051172315 9:14331073-14331095 GAGAAACCATTGCCCCAGGGAGG - Intronic
1052677334 9:31644328-31644350 TAGGTACACTTGTCCCATGGTGG + Intergenic
1059271270 9:113071646-113071668 CAGGAACCCGGGCCCCCCGGTGG - Intergenic
1060275806 9:122181588-122181610 TAGGATCTCTTGCCCCACAGAGG + Intronic
1060612204 9:124977582-124977604 TAGGATCACTTGCACCAGGGAGG + Intronic
1187472276 X:19579906-19579928 CAGGAACCCCTCCCCCATGGAGG + Intronic
1196695706 X:118609045-118609067 TGGGAACCTTTGTCCCACTGGGG - Intronic