ID: 1129462958

View in Genome Browser
Species Human (GRCh38)
Location 15:75709123-75709145
Sequence TAGGAACCCTTGCCCCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129462955_1129462958 -4 Left 1129462955 15:75709104-75709126 CCTGAGAAGCGGAGAGAGCTAGG 0: 1
1: 0
2: 1
3: 9
4: 161
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462951_1129462958 18 Left 1129462951 15:75709082-75709104 CCTGTTTGGAGTTACGGACCCTC 0: 2
1: 0
2: 0
3: 2
4: 36
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462953_1129462958 0 Left 1129462953 15:75709100-75709122 CCCTCCTGAGAAGCGGAGAGAGC 0: 1
1: 1
2: 1
3: 12
4: 194
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462950_1129462958 23 Left 1129462950 15:75709077-75709099 CCTCTCCTGTTTGGAGTTACGGA 0: 2
1: 0
2: 0
3: 9
4: 68
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1129462954_1129462958 -1 Left 1129462954 15:75709101-75709123 CCTCCTGAGAAGCGGAGAGAGCT 0: 1
1: 1
2: 0
3: 18
4: 216
Right 1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129462958 Original CRISPR TAGGAACCCTTGCCCCACGG AGG Intronic