ID: 1129463856

View in Genome Browser
Species Human (GRCh38)
Location 15:75712958-75712980
Sequence CCTTCTTAAAGGGCCCGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129463846_1129463856 -10 Left 1129463846 15:75712945-75712967 CCCCCACCCTCAACCTTCTTAAA 0: 1
1: 0
2: 1
3: 44
4: 632
Right 1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1129463839_1129463856 25 Left 1129463839 15:75712910-75712932 CCCGCTCGGGTTTCAGGCTTGGA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1129463844_1129463856 -3 Left 1129463844 15:75712938-75712960 CCACCTGCCCCCACCCTCAACCT 0: 1
1: 1
2: 17
3: 197
4: 1909
Right 1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1129463843_1129463856 -2 Left 1129463843 15:75712937-75712959 CCCACCTGCCCCCACCCTCAACC 0: 1
1: 0
2: 9
3: 187
4: 1670
Right 1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1129463841_1129463856 0 Left 1129463841 15:75712935-75712957 CCCCCACCTGCCCCCACCCTCAA 0: 1
1: 0
2: 17
3: 196
4: 1929
Right 1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1129463845_1129463856 -6 Left 1129463845 15:75712941-75712963 CCTGCCCCCACCCTCAACCTTCT 0: 1
1: 0
2: 9
3: 185
4: 1487
Right 1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1129463842_1129463856 -1 Left 1129463842 15:75712936-75712958 CCCCACCTGCCCCCACCCTCAAC 0: 1
1: 0
2: 14
3: 167
4: 1551
Right 1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1129463840_1129463856 24 Left 1129463840 15:75712911-75712933 CCGCTCGGGTTTCAGGCTTGGAC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG 0: 1
1: 0
2: 1
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129463856 Original CRISPR CCTTCTTAAAGGGCCCGTGC GGG Intergenic
901941276 1:12663810-12663832 GCTTCTTAGAGGGTCCTTGCAGG - Intronic
922659201 1:227414546-227414568 CCTTCTTAAAGGAGCAGTGGTGG - Intergenic
1070295035 10:75153311-75153333 CCTTCTAAAAGTGCCTTTGCTGG + Intronic
1071515104 10:86291924-86291946 CCTTCTCAAAGGGCCCTGGCTGG - Intronic
1072252617 10:93593628-93593650 CCTTCTCATAGGGCTCATGCAGG - Intronic
1075003500 10:118814613-118814635 CCTTCTTAGAGAGCTTGTGCAGG + Intergenic
1080616630 11:33950104-33950126 TCTTCTTAAAGAGCCAGTCCTGG - Intergenic
1096531808 12:52247333-52247355 CTTGCTTAAATGGCCCCTGCTGG - Intronic
1097152304 12:56987827-56987849 CCTTCTTGGAGGATCCGTGCAGG - Intergenic
1102695067 12:114792478-114792500 CCTTTTCAAATGGCCCGTGCTGG - Intergenic
1103854893 12:123960189-123960211 CTTTCTTAAAGGGCCAGCCCAGG - Intronic
1104283066 12:127396093-127396115 CCTTCTCAAAGGTCACGTCCTGG + Intergenic
1105766603 13:23566341-23566363 TTTTCTTAAAGGGCCAGTTCAGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1107967270 13:45608667-45608689 CCTTCTTAAATAGCCACTGCAGG - Intronic
1111675691 13:91385505-91385527 TCTTCTTTAAGAGCCGGTGCGGG - Intergenic
1122235246 14:100327587-100327609 CCTTCCTGAGGGGGCCGTGCTGG - Intronic
1127068604 15:55265933-55265955 CCTGCATAAAGAGCCCGTGGTGG - Intronic
1129257999 15:74345104-74345126 CCTTCTTGATGCGCCTGTGCAGG + Exonic
1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG + Intergenic
1132846628 16:2003814-2003836 CCTTCTTAGAGGGTCTGTGAGGG - Intronic
1133060471 16:3171372-3171394 CCTTCTTTAAGGACCTGAGCAGG - Intergenic
1139591773 16:67936880-67936902 CCTTCCTCAAAGGCCCGTGGCGG + Exonic
1141427393 16:83953058-83953080 CAGCCTTAAAGGGCCCCTGCTGG - Intronic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1147184664 17:38706546-38706568 ATTTCTTAAAGGGCCAGTGAGGG - Intronic
1152039724 17:77894920-77894942 GCTTCATAAAGGGCCCTTCCCGG + Intergenic
1153526364 18:5998450-5998472 CCTTCCTGAAGGGCCCCTCCAGG - Intronic
1154304446 18:13219689-13219711 CCTTCTCGAAGGGCTAGTGCTGG + Intronic
1159555842 18:69943622-69943644 CCTTCTTCAAGGGCCCTGGTGGG + Intronic
929906495 2:46050634-46050656 CCTCATTAAGGGGCCAGTGCTGG - Intronic
932817520 2:74873956-74873978 CGTGCATGAAGGGCCCGTGCTGG + Intronic
945318206 2:208393005-208393027 CCTTCTTAAAATGCCCTGGCTGG + Intronic
946572569 2:221040847-221040869 CCTTCTTACATGGCAGGTGCTGG + Intergenic
946622220 2:221572657-221572679 CCATCTTAAACCGCCCGTGGTGG - Intronic
947450582 2:230204711-230204733 CCTTCCAAAAGAGCCAGTGCTGG + Intronic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1169427003 20:5504363-5504385 CCTTCTCCAAGGCCCGGTGCAGG + Intergenic
1185234503 22:49704331-49704353 CCTTCTCAAAAGGGCCCTGCTGG + Intergenic
952880234 3:37980800-37980822 CCTTCTTTGAGGGCCTGAGCCGG + Exonic
961734957 3:128995523-128995545 CCTTGTTAAAGGGCCCTTTTGGG - Intronic
962714691 3:138115898-138115920 CCCTCCTAAAGGGACCGTCCTGG + Intergenic
968516555 4:1017996-1018018 TCTTCTGGAAGGGCCCGTCCTGG - Intronic
969721459 4:8894818-8894840 CCTTCTGAACGGGGCCCTGCGGG + Intergenic
972381364 4:38523230-38523252 TCTTCTGAAAGGGCCGGTGCAGG + Intergenic
973631704 4:52825996-52826018 GCTTCTTACAGGGCCTATGCAGG + Intergenic
979219851 4:118210474-118210496 CCTTTTAAAAGGGACCCTGCTGG + Intronic
981013595 4:139951174-139951196 TCTTTGTAAAGGGCCTGTGCTGG + Intronic
981173829 4:141657234-141657256 CCATCTTAAGGGGCCTATGCAGG - Intronic
985960513 5:3299588-3299610 CCTTTTTGAAGGGCCAGAGCAGG + Intergenic
988553719 5:32219008-32219030 GCTTCTCAAAGGGCACGTGCAGG - Intergenic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
1007961771 6:45966755-45966777 ACTTCTTTCAGGGCCTGTGCAGG - Intronic
1017146381 6:151239672-151239694 CCTTCTTTGAGGGCCTGTGCTGG - Intergenic
1019270508 7:144511-144533 TCTTGTTACAGGGCCCGTGGTGG + Intergenic
1023848603 7:44138362-44138384 CTTTCACAAAGGGCCCATGCAGG + Intergenic
1025769634 7:64491932-64491954 CCTACTTATGGGGCCCATGCTGG + Intergenic
1029381758 7:100219793-100219815 CCTTCTTAAAGTGACAGTGAGGG - Exonic
1029401923 7:100352243-100352265 CCTTCTTAAAGTGACAGTGAGGG - Exonic
1035082456 7:156228319-156228341 CCTTCTTAAAAGACACGTCCAGG - Intergenic
1035128443 7:156628553-156628575 TCTTCTTAAATGGCCAGAGCAGG - Intergenic
1035394453 7:158526125-158526147 GCTTCTGAAAGGGCCCGCTCTGG + Intronic
1038324993 8:26566334-26566356 CCTCCCTAAAGGGGCCCTGCAGG + Intronic
1039073870 8:33671175-33671197 CCTAGTTAAAGAGCCTGTGCAGG + Intergenic
1042358199 8:67852891-67852913 CCTTCTTAGAAGGCCTGTGTGGG + Intergenic
1049151814 8:141040036-141040058 CCTTCCTAATGGGCCCGACCTGG + Intergenic
1050521963 9:6510208-6510230 GCTTCTTAGAGGGACCATGCAGG + Intergenic
1059955749 9:119514417-119514439 CCTTCTGAAAGGGCCAGGGAAGG - Intronic
1061368994 9:130187398-130187420 CGCTCTTAAAGGGCCAGAGCCGG + Intronic
1187780496 X:22817250-22817272 CTTTCTTCAAGGCCCTGTGCCGG - Intergenic
1198079728 X:133227981-133228003 CCTTCTTTCAGGGCCTGTGTGGG + Intergenic