ID: 1129465470

View in Genome Browser
Species Human (GRCh38)
Location 15:75722127-75722149
Sequence TGGGGAGGCCTGAGCTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129465462_1129465470 -1 Left 1129465462 15:75722105-75722127 CCAGGGCATTGGTGGTGGTCCCT No data
Right 1129465470 15:75722127-75722149 TGGGGAGGCCTGAGCTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129465470 Original CRISPR TGGGGAGGCCTGAGCTATCA GGG Intergenic
No off target data available for this crispr