ID: 1129467703

View in Genome Browser
Species Human (GRCh38)
Location 15:75733129-75733151
Sequence CTGCCCTGGATGACCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129467703_1129467711 4 Left 1129467703 15:75733129-75733151 CCTCCTCAGGTCATCCAGGGCAG No data
Right 1129467711 15:75733156-75733178 TTGGGCTAGGCTTTCAGGGTAGG No data
1129467703_1129467712 5 Left 1129467703 15:75733129-75733151 CCTCCTCAGGTCATCCAGGGCAG No data
Right 1129467712 15:75733157-75733179 TGGGCTAGGCTTTCAGGGTAGGG No data
1129467703_1129467710 0 Left 1129467703 15:75733129-75733151 CCTCCTCAGGTCATCCAGGGCAG No data
Right 1129467710 15:75733152-75733174 AAGCTTGGGCTAGGCTTTCAGGG No data
1129467703_1129467713 26 Left 1129467703 15:75733129-75733151 CCTCCTCAGGTCATCCAGGGCAG No data
Right 1129467713 15:75733178-75733200 GGTGCTTCCCTCCATCCCTGTGG No data
1129467703_1129467708 -9 Left 1129467703 15:75733129-75733151 CCTCCTCAGGTCATCCAGGGCAG No data
Right 1129467708 15:75733143-75733165 CCAGGGCAGAAGCTTGGGCTAGG No data
1129467703_1129467709 -1 Left 1129467703 15:75733129-75733151 CCTCCTCAGGTCATCCAGGGCAG No data
Right 1129467709 15:75733151-75733173 GAAGCTTGGGCTAGGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129467703 Original CRISPR CTGCCCTGGATGACCTGAGG AGG (reversed) Intergenic
No off target data available for this crispr