ID: 1129468213

View in Genome Browser
Species Human (GRCh38)
Location 15:75736054-75736076
Sequence AAGCAGGGTTAGATGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129468213_1129468216 -9 Left 1129468213 15:75736054-75736076 CCATGTACCATCTAACCCTGCTT No data
Right 1129468216 15:75736068-75736090 ACCCTGCTTTAGGTTTAGAGTGG No data
1129468213_1129468226 28 Left 1129468213 15:75736054-75736076 CCATGTACCATCTAACCCTGCTT No data
Right 1129468226 15:75736105-75736127 CATTATGGGTGATTCCTCACTGG No data
1129468213_1129468220 14 Left 1129468213 15:75736054-75736076 CCATGTACCATCTAACCCTGCTT No data
Right 1129468220 15:75736091-75736113 CTCTAGTCTCCCCCCATTATGGG No data
1129468213_1129468219 13 Left 1129468213 15:75736054-75736076 CCATGTACCATCTAACCCTGCTT No data
Right 1129468219 15:75736090-75736112 GCTCTAGTCTCCCCCCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129468213 Original CRISPR AAGCAGGGTTAGATGGTACA TGG (reversed) Intergenic
No off target data available for this crispr