ID: 1129470152

View in Genome Browser
Species Human (GRCh38)
Location 15:75749072-75749094
Sequence AAAAGGAAACTTGTGGTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129470150_1129470152 -7 Left 1129470150 15:75749056-75749078 CCTGAAATAAATGAATAAAAGGA No data
Right 1129470152 15:75749072-75749094 AAAAGGAAACTTGTGGTTAGTGG No data
1129470147_1129470152 -2 Left 1129470147 15:75749051-75749073 CCCTGCCTGAAATAAATGAATAA No data
Right 1129470152 15:75749072-75749094 AAAAGGAAACTTGTGGTTAGTGG No data
1129470148_1129470152 -3 Left 1129470148 15:75749052-75749074 CCTGCCTGAAATAAATGAATAAA No data
Right 1129470152 15:75749072-75749094 AAAAGGAAACTTGTGGTTAGTGG No data
1129470146_1129470152 17 Left 1129470146 15:75749032-75749054 CCTGGGTGTCACGGCAAAACCCT No data
Right 1129470152 15:75749072-75749094 AAAAGGAAACTTGTGGTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129470152 Original CRISPR AAAAGGAAACTTGTGGTTAG TGG Intergenic
No off target data available for this crispr