ID: 1129470477

View in Genome Browser
Species Human (GRCh38)
Location 15:75750914-75750936
Sequence CCTCACAGGCAGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129470477_1129470487 -6 Left 1129470477 15:75750914-75750936 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129470487 15:75750931-75750953 GTGAGGTGGGTGGGGCCAGAAGG No data
1129470477_1129470491 13 Left 1129470477 15:75750914-75750936 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129470491 15:75750950-75750972 AAGGAGAGGCATTCACCTGTGGG No data
1129470477_1129470490 12 Left 1129470477 15:75750914-75750936 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129470490 15:75750949-75750971 GAAGGAGAGGCATTCACCTGTGG No data
1129470477_1129470488 -1 Left 1129470477 15:75750914-75750936 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129470488 15:75750936-75750958 GTGGGTGGGGCCAGAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129470477 Original CRISPR CCTCACAGGCAGAAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr